Knowledge

Telomere

Source 📝

515:(ROS), can lead to DNA damage; however, it is yet unclear whether the elevated rate in telomeres is brought about by their inherent susceptibility or a diminished activity of DNA repair systems in these regions. Despite widespread agreement of the findings, widespread flaws regarding measurement and sampling have been pointed out; for example, a suspected species and tissue dependency of oxidative damage to telomeres is said to be insufficiently accounted for. Population-based studies have indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E. These results suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress. 294:). The last primer to be involved in lagging-strand replication sits near the 3'-end of the template (corresponding to the potential 5'-end of the lagging-strand). Originally it was believed that the last primer would sit at the very end of the template, thus, once removed, the DNA-polymerase that substitutes primers with DNA (DNA-Pol δ in eukaryotes) would be unable to synthesize the "replacement DNA" from the 5'-end of the lagging strand so that the template nucleotides previously paired to the last primer would not be replicated. It has since been questioned whether the last lagging strand primer is placed exactly at the 3'-end of the template and it was demonstrated that it is rather synthesized at a distance of about 70–100 nucleotides which is consistent with the finding that DNA in cultured human cell is shortened by 50–100 415: 574: 4979: 5478: 1296: 208:
that determines the number of divisions that a certain cell clone can undergo. Furthermore, it was predicted that a specialized DNA polymerase (originally called a tandem-DNA-polymerase) could extend telomeres in immortal tissues such as germ line, cancer cells and stem cells. It also followed from this hypothesis that organisms with circular genome, such as bacteria, do not have the end replication problem and therefore do not age.
265: 1111: 1273:
across vertebrates. Phylogeny and life history traits such as body size or the pace of life can also affect telomere dynamics. For example, it has been described across species of birds and mammals. In 2019, a meta-analysis confirmed that the exposure to stressors (e.g. pathogen infection, competition, reproductive effort and high activity level) was associated with shorter telomeres across different animal taxa.
1203: 5490: 348: 31: 565:. The literature concerning telomeres as integrative biomarkers of exposure to stress and adversity is dominated by cross-sectional and correlational studies, which makes causal interpretation problematic. A 2020 review argued that the relationship between psychosocial stress and telomere length appears strongest for stress experienced in utero or early life. 1244:(WGS) experiments. Amongst these are TelSeq, Telomerecat and telomereHunter. Length estimation from WGS typically works by differentiating telomere sequencing reads and then inferring the length of telomere that produced that number of reads. These methods have been shown to correlate with preexisting methods of estimation such as PCR and TRF. 601:, that tied telomere shortening with the Hayflick limit. The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in 290:) then being excised and substituted by DNA. The lagging strand, however, is oriented 3'-5' with respect to the replication fork so continuous replication by DNA-polymerase is impossible, which necessitates discontinuous replication involving the repeated synthesis of primers further 5' of the site of initiation (see 625:
A study reported that telomere length of different mammalian species correlates inversely rather than directly with lifespan, and concluded that the contribution of telomere length to lifespan remains controversial. There is little evidence that, in humans, telomere length is a significant biomarker
361:
At the very 3'-end of the telomere there is a 300 base pair overhang which can invade the double-stranded portion of the telomere forming a structure known as a T-loop. This loop is analogous to a knot, which stabilizes the telomere, and prevents the telomere ends from being recognized as breakpoints
1272:
estimates vary greatly within and among species. Age and telomere length often negatively correlate in vertebrates, but this decline is variable among taxa and linked to the method used for estimating telomere length. In contrast, the available information shows no sex differences in telomere length
305:
If coding sequences are degraded in this process, potentially vital genetic code would be lost. Telomeres are non-coding, repetitive sequences located at the termini of linear chromosomes to act as buffers for those coding sequences further behind. They "cap" the end-sequences and are progressively
207:
division, Olovnikov suggested that DNA sequences are lost every time a cell replicates until the loss reaches a critical level, at which point cell division ends. According to his theory of marginotomy, DNA sequences at the ends of telomeres are represented by tandem repeats, which create a buffer
428:
Many organisms have a ribonucleoprotein enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase "replenishes" the telomere "cap" and requires no ATP. In most multicellular eukaryotic organisms, telomerase is active only in
477:
ranging from 75 to 300 bases, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified. These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or
362:
by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion would result. The T-loop is maintained by several proteins, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as
482:. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a 457:. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. 184:, working with maize. Muller observed that the ends of irradiated fruit fly chromosomes did not present alterations such as deletions or inversions. He hypothesized the presence of a protective cap, which he coined "telomeres", from the Greek 541:
Telomere shortening is associated with aging, mortality, and aging-related diseases in experimental animals. Although many factors can affect human lifespan, such as smoking, diet, and exercise, as persons approach the upper limit of human
406:) to form such G-quadruplexes that accommodate it, rather than a T-loop. G-quadruplexes present an obstacle for enzymes such as DNA-polymerases and are thus thought to be involved in the regulation of replication and transcription. 398:, a special conformation of DNA involving non-Watson-Crick base pairing. There are different subtypes depending on the involvement of single- or double-stranded DNA, among other things. There is evidence for the 3'-overhang in 1228:
Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment (TRF) southern blot. There is a Web-based Analyser of the Length of Telomeres
285:
to initiate replication. On the leading strand (oriented 5'-3' within the replication fork), DNA-polymerase continuously replicates from the point of initiation all the way to the strand's end with the primer (made of
529:
Although telomeres shorten during the lifetime of an individual, it is telomere shortening-rate rather than telomere length that is associated with the lifespan of a species. Critically short telomeres trigger a
1263:
During the last two decades, eco-evolutionary studies have investigated the relevance of life-history traits and environmental conditions on telomeres of wildlife. Most of these studies have been conducted in
280:
of the parent strands. This is a consequence of its unidirectional mode of DNA synthesis: it can only attach new nucleotides to an existing 3'-end (that is, synthesis progresses 5'-3') and thus it requires a
3451:
Fajkus, Petr; Adámik, Matej; Nelson, Andrew D L; Kilar, Agata M; Franek, Michal; Bubeník, Michal; Frydrychová, Radmila Čapková; Votavová, Alena; Sýkorová, Eva; Fajkus, Jiří; Peška, Vratislav (2023-01-11).
2012:
Lanza RP, Cibelli JB, Blackwell C, Cristofalo VJ, Francis MK, Baerlocher GM, et al. (April 2000). "Extension of cell life-span and telomere length in animals cloned from senescent somatic cells".
1248:
is used to quantify the length of telomeres in human white blood cells. A semi-automated method for measuring the average length of telomeres with Flow FISH was published in Nature Protocols in 2006.
335:), however, are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and function. The known structures of bacterial telomeres take the form of 1678:
Olovnikov AM (September 1973). "A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon".
1251:
While multiple companies offer telomere length measurement services, the utility of these measurements for widespread clinical or personal use has been questioned. Nobel Prize winner
1237:
assay for telomere length involves determining the Telomere-to-Single Copy Gene (T/S) ratio, which is demonstrated to be proportional to the average telomere length in a cell.
5760: 5463: 3100:
Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, et al. (January 1998). "Extension of life-span by introduction of telomerase into normal human cells".
1004: 1280:, and other non-mammalian organisms, show that there is no single universal model of telomere erosion; rather, there is wide variation in relevant dynamics across 725: 3258:
Harris SE, Martin-Ruiz C, von Zglinicki T, Starr JM, Deary IJ (July 2012). "Telomere length and aging biomarkers in 70-year-olds: the Lothian Birth Cohort 1936".
232: 4902: 1064: 199:
first recognized that chromosomes could not completely replicate their ends; this is known as the "end replication problem". Building on this, and accommodating
581:
is the theoretical limit to the number of times a cell may divide until the telomere becomes so short that division is inhibited and the cell enters senescence.
5817: 5842: 5792: 1511:"A theory of marginotomy: The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon" 5852: 577:
The average cell will divide between 50 and 70 times before cell death. As the cell divides the telomeres on the end of the chromosome get smaller. The
5974: 5892: 2744: 309:
The "end replication problem" is exclusive to linear chromosomes as circular chromosomes do not have ends lying without reach of DNA-polymerases. Most
561:
was associated with a small decrease in telomere length—but that these associations attenuate to no significant association when accounting for
5882: 5797: 1121: 1052: 538:. Mice have much longer telomeres, but a greatly accelerated telomere shortening-rate and greatly reduced lifespan compared to humans and elephants. 4122:
Remot, Florentin; Ronget, Victor; Froy, Hannah; Rey, Benjamin; Gaillard, Jean-Michel; Nussey, Daniel H.; Lemaître, Jean-François (November 2020).
3866:
Baerlocher GM, Vulto I, de Jong G, Lansdorp PM (December 2006). "Flow cytometry and FISH to measure the average length of telomeres (flow FISH)".
3301:
Lyčka, Martin; Bubeník, Michal; Závodník, Michal; Peska, Vratislav; Fajkus, Petr; Demko, Martin; Fajkus, Jiří; Fojtová, Miloslava (2023-08-21).
634:
Experimentally verified and predicted telomere sequence motifs from more than 9000 species are collected in research community curated database
4057:
Remot, Florentin; Ronget, Victor; Froy, Hannah; Rey, Benjamin; Gaillard, Jean-Michel; Nussey, Daniel H.; Lemaitre, Jean-François (2021-09-07).
1622:
Blackburn EH, Gall JG (March 1978). "A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena".
5802: 4403: 1723:"Early and late steps in telomere overhang processing in normal human cells: the position of the final RNA primer drives telomere shortening" 524: 5528: 2783:"Divergence of sperm and leukocyte age-dependent telomere dynamics: implications for male-driven evolution of telomere length in humans" 5897: 3360:"Characterisation of an unusual telomere motif (TTTTTTAGGG)n in the plant Cestrum elegans (Solanaceae), a species with a large genome" 5862: 5812: 5807: 1217: 3601:
Lyčka, Martin; Peska, Vratislav; Demko, Martin; Spyroglou, Ioannis; Kilar, Agata; Fajkus, Jiří; Fojtová, Miloslava (December 2021).
5837: 5787: 4968: 4800: 3049:
Feng J, Funk WD, Wang SS, Weinrich SL, Avilion AA, Chiu CP, et al. (September 1995). "The RNA component of human telomerase".
2635:"Perceived stress and telomere length: A systematic review, meta-analysis, and methodologic considerations for advancing the field" 3211:"Comparative biology of mammalian telomeres: hypotheses on ancestral states and the roles of telomeres in longevity determination" 2936:
Rentscher KE, Carroll JE, Mitchell C (April 2020). "Psychosocial Stressors and Telomere Length: A Current Review of the Science".
5832: 5737: 4935: 4855: 4850: 5857: 5144: 1808: 3558:
Rufer N, et al. (August 1998). "Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry".
4892: 4533: 235: 223:, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Blackburn, 4897: 4655: 4197:"On the comparative biology of mammalian telomeres: Telomere length co-evolves with body mass, lifespan and cancer risk" 614:
demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of
339:
bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.
5714: 5701: 1182: 474: 277: 607:
to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.
6027: 5724: 4396: 1783: 1154: 1140: 4672: 5521: 5453: 5175: 1161: 5494: 5458: 1360: 2332:"Characterization of the yeast telomere nucleoprotein core: Rap1 binds independently to each recognition site" 5755: 5601: 5588: 5302: 5069: 4518: 4083: 2881:"Telomeres as integrative markers of exposure to stress and adversity: a systematic review and meta-analysis" 446: 121: 104: 5506: 4389: 1658:"Elizabeth H. Blackburn, Carol W. Greider, Jack W. Szostak: The Nobel Prize in Physiology or Medicine 2009" 20: 1168: 5292: 4928: 1230: 3760:"Telomerecat: A ploidy-agnostic method for estimating telomere length from whole genome sequencing data" 3401:"Allium telomeres unmasked: the unusual telomeric sequence (CTCGGTTATGGG)n is synthesized by telomerase" 1657: 6022: 5872: 5514: 5149: 1319: 1268:, i.e. birds and mammals. They have provided evidence for the inheritance of telomere length; however, 622:) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres. 282: 1212:
Preliminary research indicates that disease risk in aging may be associated with telomere shortening,
449:. The steady shortening of telomeres with each replication in somatic (body) cells may have a role in 170:
The existence of a special structure at the ends of chromosomes was independently proposed in 1938 by
4963: 4665: 3603:"WALTER: an easy way to online evaluate telomere lengths from terminal restriction fragment analysis" 1234: 1150: 1129: 972: 24: 5319: 4998: 4958: 4719: 4503: 1350: 1076: 990: 479: 6037: 5566: 5541: 5215: 4993: 2979:
Hayflick L, Moorhead PS (December 1961). "The serial cultivation of human diploid cell strains".
1241: 1125: 615: 512: 176: 3399:
Fajkus P, Peška V, Sitová Z, Fulnečková J, Dvořáčková M, Gogela R, et al. (February 2016).
1255:, who was co-founder of one company, promoted the clinical utility of telomere length measures. 5996: 5924: 5482: 5387: 5372: 5200: 5094: 5074: 4921: 4625: 4598: 2263:
Telomeric 8-oxo-guanine drives rapid premature senescence in the absence of telomere shortening
97: 2279:
Shampay J, Szostak JW, Blackburn EH (1984). "DNA sequences of telomeres maintained in yeast".
2063:
Whittemore, Kurt; Vera, Elsa; Martínez-Nevado, Eva; Sanpera, Carola; Blasco, Maria A. (2019).
4660: 4558: 4059:"Decline in telomere length with increasing age across nonhuman vertebrates: A meta-analysis" 3817:"TelomereHunter–in silico estimation of telomere content and composition from cancer genomes" 2949: 647: 414: 313:, relying on circular chromosomes, accordingly do not possess telomeres. A small fraction of 171: 3209:
Gomes NM, Ryder OA, Houck ML, Charter SJ, Walker W, Forsyth NR, et al. (October 2011).
1928:
Lipps HJ, Rhodes D (August 2009). "G-quadruplex structures: in vivo evidence and function".
6017: 5969: 5683: 5545: 5412: 5275: 5139: 5089: 4880: 4805: 4790: 4620: 4568: 4543: 4483: 4246:"The association between stressors and telomeres in non-human vertebrates: a meta-analysis" 4135: 3771: 3167: 3109: 3058: 2892: 2781:
Aston KI, Hunt SC, Susser E, Kimura M, Factor-Litvak P, Carrell D, Aviv A (November 2012).
2381:
Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, de Lange T (May 1999).
2288: 2076: 2021: 1882: 1687: 1522: 1334: 1088: 954: 857: 558: 507:
and that oxidative stress-mediated DNA damage has a major influence on telomere shortening
438: 3910: 3358:
Peška V, Fajkus P, Fojtová M, Dvořáčková M, Hapala J, Dvořáček V, et al. (May 2015).
2581:
Shen J, Gammon MD, Terry MB, Wang Q, Bradshaw P, Teitelbaum SL, et al. (April 2009).
473:-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 154:
from progressive degradation and ensure the integrity of linear chromosomes by preventing
8: 5747: 5618: 5297: 5280: 5260: 5240: 4548: 4357: 3271: 2693: 1252: 809: 535: 212: 159: 4307:
Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences
4139: 3775: 3511:"Human telomeres contain at least three types of G-rich repeat distributed non-randomly" 3453: 3335: 3171: 3113: 3062: 3014:
Hayflick L (March 1965). "The limited in vitro lifetime of human diploid cell strains".
2896: 2292: 2080: 2025: 1886: 1691: 1526: 6032: 5919: 5827: 5646: 5307: 5053: 4327: 4302: 4283: 4177: 4164: 4104: 4034: 3953: 3891: 3843: 3816: 3792: 3759: 3735: 3710: 3637: 3602: 3583: 3486: 3430: 3283: 3235: 3210: 3191: 3133: 3082: 2961: 2913: 2880: 2856: 2831: 2807: 2782: 2715: 2688: 2659: 2634: 2607: 2582: 2558: 2529: 2505: 2480: 2456: 2431: 2412: 2358: 2331: 2312: 2243: 2189: 2172: 2107: 2064: 2045: 1989: 1964: 1772: 1747: 1722: 1601: 1437: 1040: 785: 593:. Significant discoveries were subsequently made by a group of scientists organized at 181: 4372: 4363: 4360:, which includes a reference to the impact of stress, and pessimism on telomere length 4353: 3686: 3661: 3535: 3510: 3303:"TeloBase: a community-curated database of telomere sequences across the tree of life" 2399: 2382: 1905: 1870: 1510: 1175: 5432: 5427: 5382: 5205: 5079: 4610: 4522: 4332: 4287: 4275: 4267: 4226: 4218: 4181: 4169: 4151: 4108: 4096: 4088: 4039: 4021: 3945: 3883: 3848: 3797: 3740: 3691: 3642: 3624: 3575: 3540: 3491: 3473: 3434: 3422: 3381: 3340: 3322: 3275: 3240: 3226: 3183: 3179: 3125: 3074: 3031: 3027: 2996: 2992: 2965: 2953: 2918: 2861: 2812: 2763: 2720: 2664: 2612: 2563: 2510: 2461: 2404: 2363: 2304: 2262: 2235: 2194: 2153: 2112: 2094: 2037: 1994: 1945: 1910: 1851: 1846: 1829: 1789: 1779: 1752: 1703: 1699: 1639: 1635: 1593: 1585: 1581: 1546: 1538: 1534: 1491: 1483: 1429: 1421: 1329: 925: 702: 603: 594: 483: 3957: 3895: 3587: 3287: 3195: 3152: 3137: 2247: 2049: 1605: 1441: 643: 478:
T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by
150:. In most, if not all species possessing them, they protect the terminal regions of 5981: 5911: 5549: 5362: 5329: 5084: 4699: 4578: 4322: 4314: 4257: 4208: 4159: 4143: 4078: 4070: 4029: 4013: 3980: 3937: 3875: 3838: 3828: 3787: 3779: 3730: 3722: 3681: 3673: 3632: 3614: 3567: 3530: 3522: 3481: 3465: 3454:"Telomerase RNA in Hymenoptera (Insecta) switched to plant/ciliate-like biogenesis" 3412: 3371: 3330: 3314: 3267: 3230: 3222: 3175: 3117: 3086: 3066: 3023: 2988: 2945: 2908: 2900: 2851: 2843: 2802: 2794: 2753: 2710: 2702: 2654: 2646: 2602: 2594: 2553: 2545: 2500: 2492: 2451: 2443: 2394: 2353: 2343: 2316: 2296: 2225: 2184: 2143: 2102: 2084: 2029: 1984: 1976: 1937: 1900: 1890: 1841: 1742: 1734: 1695: 1631: 1577: 1530: 1413: 1309: 1028: 1016: 937: 586: 562: 504: 442: 200: 196: 49: 2416: 1136: 445:. Telomerase can be reactivated and telomeres reset back to an embryonic state by 5692: 5664: 5633: 5628: 5195: 5190: 5180: 4692: 4513: 4461: 4124:"No sex differences in adult telomere length across vertebrates: a meta-analysis" 3121: 2330:
Williams TL, Levy DL, Maki-Yonekura S, Yonekura K, Blackburn EH (November 2010).
2033: 869: 598: 543: 259: 216: 2633:
Mathur MB, Epel E, Kind S, Desai M, Parks CG, Sandler DP, Khazeni N (May 2016).
5964: 5822: 5779: 5607: 5597: 5367: 5344: 5250: 5245: 5185: 5170: 5134: 5019: 4583: 4507: 3783: 3619: 2758: 2739: 2706: 1875:
Proceedings of the National Academy of Sciences of the United States of America
1301: 1213: 684: 590: 578: 291: 273: 220: 3833: 2650: 2496: 1941: 6011: 5929: 5669: 5592: 5583: 5575: 5536: 5265: 5220: 5129: 4944: 4563: 4367: 4271: 4222: 4155: 4092: 4025: 3628: 3526: 3477: 3326: 2267: 2098: 1793: 1589: 1542: 1487: 1472:"[Principle of marginotomy in template synthesis of polynucleotides]" 1425: 896: 748: 554: 325: 299: 224: 4381: 4001: 3677: 3070: 2798: 2348: 2148: 2131: 2089: 1980: 1895: 1401: 626:
of normal aging with respect to important cognitive and physical abilities.
5941: 5417: 5402: 5314: 5255: 5154: 5124: 5033: 4538: 4412: 4376: 4336: 4318: 4279: 4230: 4173: 4100: 4043: 4017: 3949: 3887: 3879: 3852: 3801: 3744: 3695: 3646: 3495: 3469: 3426: 3385: 3344: 3279: 3244: 3187: 3035: 3000: 2957: 2922: 2865: 2816: 2767: 2724: 2668: 2616: 2567: 2549: 2514: 2465: 2408: 2367: 2230: 2213: 2198: 2157: 2116: 2041: 1998: 1949: 1855: 1756: 1738: 1565: 1471: 1433: 1355: 1269: 737: 679: 469:
in yeast to many kilobases in humans, and usually is composed of arrays of
395: 319: 228: 204: 3985: 3972: 3579: 3544: 3318: 3129: 3078: 2847: 2308: 2239: 1914: 1707: 1597: 1550: 1495: 1284:, and even within smaller taxonomic groups these patterns appear diverse. 5936: 5847: 5709: 5407: 5397: 5392: 4757: 4752: 4615: 4593: 4588: 4456: 4123: 3726: 2447: 1871:"Conservation of the human telomere sequence (TTAGGG)n among vertebrates" 1643: 1324: 913: 832: 815: 779: 755: 713: 4978: 4147: 3571: 2904: 2583:"Telomere length, oxidative damage, antioxidants and breast cancer risk" 1417: 238:
for the discovery of how chromosomes are protected by telomeres and the
5948: 5765: 5334: 5287: 5210: 5119: 4777: 4767: 4762: 4747: 4687: 4677: 4553: 4527: 4478: 4468: 4416: 4058: 3928:
von Zglinicki T (March 2012). "Will your telomeres tell your future?".
2481:"The impact of oxidative DNA damage and stress on telomere homeostasis" 1339: 1314: 1240:
Tools have also been developed to estimate the length of telomere from
1139:
if you can. Unsourced or poorly sourced material may be challenged and
892: 839: 797: 670: 639: 531: 465:
Telomere length varies greatly between species, from approximately 300
450: 423: 403: 391: 379: 310: 242: 155: 139: 135: 35: 4262: 4245: 4213: 4196: 4074: 4006:
Philosophical Transactions of the Royal Society B: Biological Sciences
4002:"Heritability of telomere variation: it is all about the environment!" 3941: 3417: 3400: 3376: 3359: 3302: 2598: 1402:"2009 Nobel Prize in Physiology or Medicine: telomeres and telomerase" 635: 511:. There is a multitude of ways in which oxidative stress, mediated by 5867: 5558: 4729: 4473: 4451: 4432: 4244:
Chatelain, Marion; Drobniak, Szymon M.; Szulkin, Marta (2019-11-27).
2300: 1345: 1277: 1265: 1245: 948: 761: 573: 466: 434: 430: 356: 295: 147: 146:). Telomeres are a widespread genetic feature most commonly found in 138:
sequences associated with specialized proteins at the ends of linear
127: 110: 2062: 5877: 5641: 5537: 5437: 4499: 3257: 1295: 821: 719: 500: 336: 331: 314: 2132:"Senescence and immortalization: role of telomeres and telomerase" 585:
The phenomenon of limited cellular division was first observed by
5887: 5377: 5270: 5048: 5043: 4885: 4739: 4650: 4645: 2329: 2266:, Nature, June 30, 2022; Nat Struct Mol Biol 29, 639–652 (2022). 1281: 772: 611: 508: 470: 399: 387: 383: 264: 4913: 30: 5986: 5422: 5014: 4795: 4682: 4446: 4442: 4437: 2737: 2380: 2011: 907: 881: 696: 454: 239: 3865: 3557: 3153:"Measuring vertebrate telomeres: applications and limitations" 2740:"Telomerase as a Therapeutic Target in Cardiovascular Disease" 82: 70: 5732: 5464:
List of largest biomedical companies by market capitalization
5324: 4860: 4845: 4840: 4835: 4830: 4825: 4820: 4815: 4810: 4785: 4723: 4303:"Ectothermic telomeres: it's time they came in from the cold" 2686: 984: 966: 851: 675: 371: 367: 363: 158:
systems from mistaking the very ends of the DNA strand for a
3711:"Estimating telomere length from whole genome sequence data" 3357: 5038: 3398: 549: 503:
studies have shown that telomeres accumulate damage due to
375: 347: 88: 64: 58: 3099: 2430:
Burge S, Parkinson GN, Hazel P, Todd AK, Neidle S (2006).
1379:
During replication, multiple DNA-polymerases are involved.
5028: 5024: 3300: 2689:"Telomere dysfunction in ageing and age-related diseases" 1721:
Chow TT, Zhao Y, Mak SS, Shay JW, Wright WE (June 2012).
402:(that possess telomere repeats similar to those found in 351:
Shelterin co-ordinates the T-loop formation of telomeres.
287: 151: 4243: 3600: 2935: 1566:"Telomeres, telomerase, and aging: origin of the theory" 386:. In many species, the sequence repeats are enriched in 16:
Region of repetitive nucleotide sequences on chromosomes
4903:
International System for Human Cytogenetic Nomenclature
4364:
Telomerase and the Consequences of Telomere Dysfunction
4000:
Dugdale, Hannah L.; Richardson, David S. (2018-01-15).
3450: 2429: 2278: 4195:
Pepke, Michael Le; Eisenberg, Dan T. A. (2021-03-16).
3508: 3208: 2478: 2780: 2687:
Rossiello F, Jurk D, Passos JF, di Fagagna F (2022).
2065:"Telomere shortening rate predicts species life span" 1233:), software processing the TRF pictures. A Real-Time 4300: 3150: 3048: 2832:"Telomeres and the natural lifespan limit in humans" 2173:"Telomeres, telomerase, and tumorigenesis--a review" 1291: 546:, longer telomeres may be associated with lifespan. 85: 79: 61: 55: 19:
For the use of "telomere" in insect morphology, see
2878: 2632: 2580: 1965:"Telomerase Repeated Amplification Protocol (TRAP)" 76: 67: 52: 4121: 4056: 3151:Nakagawa S, Gemmell NJ, Burke T (September 2004). 2829: 2745:Arteriosclerosis, Thrombosis, and Vascular Biology 2738:Hoffmann J, Richardson G, Spyridopoulos I (2021). 2432:"Quadruplex DNA: sequence, topology and structure" 2056: 1868: 1771: 1769: 4084:20.500.11820/91f3fc9e-4a69-4ac4-a8a0-45c93ccbf3b5 3999: 2628: 2626: 2260:Barnes, R.P., de Rosa, M., Thosar, S.A., et al., 1869:Meyne J, Ratliff RL, Moyzis RK (September 1989). 6009: 2978: 2383:"Mammalian telomeres end in a large duplex loop" 2682: 2680: 2678: 2069:Proceedings of the National Academy of Sciences 1720: 638:. Some of the experimentally verified telomere 4354:Telomeres and Telomerase: The Means to the End 4194: 2879:Pepper GV, Bateson M, Nettle D (August 2018). 2623: 1827: 1135:Please review the contents of the section and 342: 276:cannot replicate the sequences present at the 5522: 4929: 4411: 4397: 4301:Olsson M, Wapstra E, Friesen C (March 2018). 3927: 2527: 1621: 2972: 2823: 2731: 2675: 1821: 1399: 525:Relationship between telomeres and longevity 306:degraded in the process of DNA replication. 3042: 1927: 1862: 1100: 665:Telomeric repeat (5' to 3' toward the end) 5529: 5515: 4936: 4922: 4404: 4390: 3662:"Telomere measurement by quantitative PCR" 3392: 2268:https://doi.org/10.1038/s41594-022-00790-y 2129: 1962: 418:Synthesis of chromosome ends by telomerase 253: 4326: 4261: 4212: 4163: 4082: 4033: 3984: 3842: 3832: 3814: 3791: 3734: 3685: 3636: 3618: 3534: 3485: 3416: 3375: 3351: 3334: 3234: 2912: 2855: 2806: 2757: 2714: 2658: 2606: 2557: 2530:"Does oxidative stress shorten telomeres 2504: 2479:Barnes R, Fouquerel E, Opresko P (2019). 2455: 2398: 2357: 2347: 2229: 2188: 2147: 2106: 2088: 1988: 1904: 1894: 1845: 1746: 1677: 1563: 1508: 1469: 1218:senescence-associated secretory phenotype 654:Some known telomere nucleotide sequences 518: 248: 4969:Competitions and prizes in biotechnology 3970: 3911:"A Blood Test Offers Clues to Longevity" 3013: 2950:10.1146/annurev-publhealth-040119-094239 1778:(5th ed.). New York: W.H. Freeman. 1770:Nelson DL, Lehninger AL, Cox MM (2008). 1400:Varela, E.; Blasco, M. A. (March 2010). 572: 550:Potential effect of psychological stress 499:Apart from the end replication problem, 413: 346: 263: 134: 'part') is a region of repetitive 29: 3908: 3757: 3659: 2211: 1830:"Role of shelterin in cancer and aging" 6010: 3509:Allshire RC, et al. (June 1989). 2830:Steenstrup T, Kark JD, Aviv A (2017). 2214:"Telomeres, telomerase and senescence" 1828:Martínez P, Blasco MA (October 2010). 1454: 215:, working as a postdoctoral fellow at 5510: 4917: 4893:List of organisms by chromosome count 4385: 3446: 3444: 2528:Reichert S, Stier A (December 2017). 1806: 268:Lagging strand during DNA replication 236:Nobel Prize in Physiology or Medicine 5489: 3708: 3272:10.1016/j.neurobiolaging.2010.11.013 2485:Mechanisms of Ageing and Development 1774:Lehninger Principles of Biochemistry 1617: 1615: 1373: 1104: 195:In the early 1970s, Soviet theorist 2336:The Journal of Biological Chemistry 2170: 1963:Mender I, Shay JW (November 2015). 494: 13: 5598:Short tandem repeat/Microsatellite 4294: 3973:"Spit test offers guide to health" 3441: 1956: 38:(grey) capped by telomeres (white) 14: 6049: 4943: 4347: 1612: 996:TGTGGGTGTGGTG (from RNA template) 5488: 5477: 5476: 4977: 3909:Pollack, Andrew (May 18, 2011). 3227:10.1111/j.1474-9726.2011.00718.x 3180:10.1111/j.1365-294X.2004.02291.x 1847:10.1111/j.1474-9726.2010.00596.x 1809:"Bacterial Chromosome Structure" 1294: 1201: 1109: 998:or G(2-3)(TG)(1-6)T (consensus) 589:, and is now referred to as the 394:, which allows the formation of 48: 5454:Index of biotechnology articles 4514:Macrochromosome/Microchromosome 4237: 4188: 4115: 4050: 3993: 3964: 3921: 3902: 3859: 3808: 3751: 3702: 3653: 3594: 3551: 3502: 3294: 3251: 3202: 3144: 3093: 3007: 2929: 2872: 2774: 2587:International Journal of Cancer 2574: 2521: 2472: 2423: 2374: 2323: 2272: 2254: 2205: 2164: 2130:Shay JW, Wright WE (May 2005). 2123: 2005: 1921: 1800: 1763: 1714: 1509:Olovnikov, A. M. (1973-09-14). 1459:. Woods Hole. pp. 181–198. 557:found that increased perceived 475:3′ single-stranded-DNA overhang 5602:Trinucleotide repeat disorders 5459:List of biotechnology articles 2938:Annual Review of Public Health 1680:Journal of Theoretical Biology 1671: 1660:. Nobel Foundation. 2009-10-05 1650: 1557: 1515:Journal of Theoretical Biology 1502: 1463: 1448: 1393: 1361:Immortal DNA strand hypothesis 1258: 1223: 1137:add the appropriate references 568: 317:chromosomes (such as those in 143: 1: 5589:Variable number tandem repeat 5303:Genetically modified organism 5070:Biotechnology industrial park 2639:Brain, Behavior, and Immunity 2400:10.1016/S0092-8674(00)80760-6 1386: 650:for letter representations). 642:sequences are also listed in 489: 447:somatic cell nuclear transfer 409: 4373:DNA Ends: Just the Beginning 3122:10.1126/science.279.5349.349 3028:10.1016/0014-4827(65)90211-9 2993:10.1016/0014-4827(61)90192-6 2787:Molecular Human Reproduction 2034:10.1126/science.288.5466.665 1700:10.1016/0022-5193(73)90198-7 1636:10.1016/0022-2836(78)90294-2 1624:Journal of Molecular Biology 1582:10.1016/0531-5565(96)00005-8 1535:10.1016/0022-5193(73)90198-7 629: 165: 21:Telomere (insect morphology) 7: 5293:Environmental biotechnology 1457:The Remaking of Chromosomes 1287: 1122:reliable medical references 343:Telomere ends and shelterin 10: 6054: 4554:Dinoflagellate chromosomes 4128:Royal Society Open Science 3784:10.1038/s41598-017-14403-y 3620:10.1186/s12859-021-04064-0 3016:Experimental Cell Research 2981:Experimental Cell Research 2885:Royal Society Open Science 2759:10.1161/ATVBAHA.120.315695 2707:10.1038/s41556-022-00842-x 2212:Greider CW (August 1990). 1476:Doklady Akademii Nauk SSSR 1320:DNA damage theory of aging 1094:GGTGTACGGATTTGATTAGGTATGT 1082:GGTGTACGGATTTGATTAGTTATGT 610:Two studies on long-lived 522: 421: 354: 292:lagging strand replication 257: 120: 103: 18: 5957: 5910: 5778: 5746: 5723: 5700: 5691: 5682: 5657: 5617: 5574: 5565: 5556: 5472: 5446: 5353: 5233: 5163: 5112: 5103: 5062: 5007: 4986: 4975: 4964:Timeline of biotechnology 4951: 4898:List of sequenced genomes 4873: 4776: 4738: 4708: 4666:Chromosomal translocation 4636: 4539:A chromosome/B chromosome 4530:(or accessory chromosome) 4492: 4423: 3834:10.1186/s12859-019-2851-0 2651:10.1016/j.bbi.2016.02.002 2497:10.1016/j.mad.2018.03.013 1942:10.1016/j.tcb.2009.05.002 1807:Maloy S (July 12, 2002). 1564:Olovnikov, A. M. (1996). 1470:Olovnikov, A. M. (1971). 1128:or relies too heavily on 982: 973:Schizosaccharomyces pombe 906: 849: 771: 712: 480:telomere-binding proteins 460: 453:and in the prevention of 174:, studying the fruit fly 25:Telomere (disambiguation) 6028:Repetitive DNA sequences 5320:Microbial biodegradation 4999:Industrial biotechnology 4959:History of biotechnology 4720:Telomere-binding protein 4534:Supernumerary chromosome 1570:Experimental Gerontology 1366: 1351:Telomere-binding protein 1101:Research on disease risk 1077:Candida pseudotropicalis 1058:GGTGTACGGATGCAGACTCGCTT 1034:GGTGTACGGATGTCTAACTTCTT 991:Saccharomyces cerevisiae 272:During DNA replication, 117: 'end' and 4994:Colors of biotechnology 3660:Cawthon RM (May 2002). 3071:10.1126/science.7544491 2349:10.1074/jbc.M110.170167 2090:10.1073/pnas.1902452116 1981:10.21769/bioprotoc.1657 1896:10.1073/pnas.86.18.7049 1727:Genes & Development 1242:whole genome sequencing 1046:GGTGTAGGATGTCACGATCATT 1005:Saccharomyces castellii 513:reactive oxygen species 254:End replication problem 177:Drosophila melanogaster 5997:Protein tandem repeats 5925:Tandemly arrayed genes 5388:Biomedical engineering 5095:Pharmaceutical company 5075:Biotechnology products 4656:Structural alterations 4319:10.1098/rstb.2016.0449 4018:10.1098/rstb.2016.0450 3880:10.1038/nprot.2006.263 3715:Nucleic Acids Research 3666:Nucleic Acids Research 3527:10.1093/nar/17.12.4611 3515:Nucleic Acids Research 3458:Nucleic Acids Research 3307:Nucleic Acids Research 2550:10.1098/rsbl.2017.0463 2436:Nucleic Acids Research 2231:10.1002/bies.950120803 1930:Trends in Cell Biology 1739:10.1101/gad.187211.112 582: 519:Association with aging 419: 352: 269: 249:Structure and function 39: 23:. For other uses, see 4673:Numerical alterations 4661:Chromosomal inversion 4559:Homologous chromosome 3986:10.1038/news.2011.330 3678:10.1093/nar/30.10.e47 3260:Neurobiology of Aging 2848:10.18632/aging.101216 2799:10.1093/molehr/gas028 2149:10.1093/carcin/bgh296 1455:Muller, H.J. (1938). 1065:Candida guillermondii 648:nucleic acid notation 620:Oceanodroma leucorhoa 576: 417: 350: 267: 172:Hermann Joseph Muller 33: 5970:Pathogenicity island 5413:Chemical engineering 5276:Reproductive cloning 5140:Hybridoma technology 5090:Human Genome Project 4881:Extrachromosomal DNA 4569:Satellite chromosome 4544:Lampbrush chromosome 4484:Nuclear organization 3815:Feuerbach L (2019). 3560:Nature Biotechnology 3470:10.1093/nar/gkac1202 2171:Wai LK (July 2004). 1335:Rejuvenation (aging) 1089:Kluyveromyces lactis 955:Ascaris lumbricoides 858:Arabidopsis thaliana 616:Leach's storm-petrel 559:psychological stress 439:embryonic stem cells 5298:Genetic engineering 5281:Therapeutic cloning 5261:Bionic architecture 5241:Animal cell culture 5008:Biological concepts 4574:Centromere position 4549:Polytene chromosome 4519:Circular chromosome 4358:Elizabeth Blackburn 4148:10.1098/rsos.200548 4140:2020RSOS....700548R 3971:Marchant J (2011). 3776:2018NatSR...8.1300F 3572:10.1038/nbt0898-743 3319:10.1093/nar/gkad672 3172:2004MolEc..13.2523N 3114:1998Sci...279..349B 3063:1995Sci...269.1236F 2905:10.1098/rsos.180744 2897:2018RSOS....580744P 2694:Nature Cell Biology 2293:1984Natur.310..154S 2081:2019PNAS..11615122W 2075:(30): 15122–15127. 2026:2000Sci...288..665L 1887:1989PNAS...86.7049M 1692:1973JThBi..41..181O 1527:1973JThBi..41..181O 1418:10.1038/onc.2010.15 1253:Elizabeth Blackburn 655: 644:Telomerase Database 597:by Geron's founder 536:cellular senescence 213:Elizabeth Blackburn 203:'s idea of limited 160:double-strand break 5920:Gene amplification 5354:Interdisciplinary 5308:Molecular genetics 5054:Selective breeding 4313:(1741): 20160449. 4012:(1741): 20160450. 3915:The New York Times 3821:BMC Bioinformatics 3764:Scientific Reports 3758:Farmery J (2018). 3727:10.1093/nar/gku181 3607:BMC Bioinformatics 2448:10.1093/nar/gkl655 1342:, biological aging 1041:Candida tropicalis 653: 583: 420: 353: 270: 182:Barbara McClintock 40: 6023:Molecular biology 6005: 6004: 5906: 5905: 5774: 5773: 5678: 5677: 5567:Repeated sequence 5542:repeated sequence 5504: 5503: 5433:Nanobiotechnology 5428:Molecular biology 5229: 5228: 5080:Biotechnology law 4911: 4910: 4869: 4868: 4606:Centromere number 4523:Linear chromosome 4375:Nobel Lecture by 4366:Nobel Lecture by 4356:Nobel Lecture by 4263:10.1111/ele.13426 4214:10.1111/mec.15870 4207:(23): 6286–6296. 4201:Molecular Ecology 4075:10.1111/mec.16145 4069:(23): 5917–5932. 4063:Molecular Ecology 3942:10.1136/bmj.e1727 3418:10.1111/tpj.13115 3405:The Plant Journal 3377:10.1111/tpj.12839 3364:The Plant Journal 3313:(D1): D311–D321. 3160:Molecular Ecology 3057:(5228): 1236–41. 2599:10.1002/ijc.24105 1733:(11): 1167–1178. 1412:(11): 1561–1565. 1330:Maximum life span 1210: 1209: 1186: 1098: 1097: 978:TTAC(A)(C)G(1-8) 926:Bombus terrestris 703:Neurospora crassa 595:Geron Corporation 484:displacement loop 443:white blood cells 390:, e.g. TTAGGG in 231:were awarded the 180:, and in 1939 by 6045: 5982:Low copy repeats 5975:Symbiosis island 5912:Gene duplication 5698: 5697: 5689: 5688: 5572: 5571: 5550:gene duplication 5531: 5524: 5517: 5508: 5507: 5492: 5491: 5480: 5479: 5330:Pharmacogenomics 5110: 5109: 5104:Basic techniques 5085:Green Revolution 5063:General concepts 4981: 4938: 4931: 4924: 4915: 4914: 4736: 4735: 4700:Polyploidization 4528:Extra chromosome 4443:Genetic material 4406: 4399: 4392: 4383: 4382: 4341: 4340: 4330: 4298: 4292: 4291: 4265: 4241: 4235: 4234: 4216: 4192: 4186: 4185: 4167: 4119: 4113: 4112: 4086: 4054: 4048: 4047: 4037: 3997: 3991: 3990: 3988: 3968: 3962: 3961: 3925: 3919: 3918: 3906: 3900: 3899: 3868:Nature Protocols 3863: 3857: 3856: 3846: 3836: 3812: 3806: 3805: 3795: 3755: 3749: 3748: 3738: 3706: 3700: 3699: 3689: 3657: 3651: 3650: 3640: 3622: 3598: 3592: 3591: 3555: 3549: 3548: 3538: 3506: 3500: 3499: 3489: 3448: 3439: 3438: 3420: 3396: 3390: 3389: 3379: 3355: 3349: 3348: 3338: 3298: 3292: 3291: 3266:(7): 1486.e3–8. 3255: 3249: 3248: 3238: 3206: 3200: 3199: 3157: 3148: 3142: 3141: 3108:(5349): 349–52. 3097: 3091: 3090: 3046: 3040: 3039: 3011: 3005: 3004: 2976: 2970: 2969: 2933: 2927: 2926: 2916: 2876: 2870: 2869: 2859: 2827: 2821: 2820: 2810: 2778: 2772: 2771: 2761: 2752:(3): 1047–1061. 2735: 2729: 2728: 2718: 2684: 2673: 2672: 2662: 2630: 2621: 2620: 2610: 2578: 2572: 2571: 2561: 2544:(12): 20170463. 2525: 2519: 2518: 2508: 2476: 2470: 2469: 2459: 2427: 2421: 2420: 2402: 2378: 2372: 2371: 2361: 2351: 2342:(46): 35814–24. 2327: 2321: 2320: 2301:10.1038/310154a0 2276: 2270: 2258: 2252: 2251: 2233: 2209: 2203: 2202: 2192: 2168: 2162: 2161: 2151: 2127: 2121: 2120: 2110: 2092: 2060: 2054: 2053: 2009: 2003: 2002: 1992: 1960: 1954: 1953: 1925: 1919: 1918: 1908: 1898: 1866: 1860: 1859: 1849: 1825: 1819: 1818: 1816: 1815: 1804: 1798: 1797: 1777: 1767: 1761: 1760: 1750: 1718: 1712: 1711: 1675: 1669: 1668: 1666: 1665: 1654: 1648: 1647: 1619: 1610: 1609: 1561: 1555: 1554: 1506: 1500: 1499: 1482:(6): 1496–1499. 1467: 1461: 1460: 1452: 1446: 1445: 1397: 1380: 1377: 1310:Epigenetic clock 1304: 1299: 1298: 1205: 1204: 1196: 1193: 1187: 1185: 1144: 1113: 1112: 1105: 1029:Candida albicans 1022:GGGGTCTGGGTGCTG 1017:Candida glabrata 938:Vespula vulgaris 656: 652: 587:Leonard Hayflick 563:publication bias 505:oxidative stress 495:Oxidative damage 433:, some types of 201:Leonard Hayflick 197:Alexey Olovnikov 131: 124: 114: 107: 95: 94: 91: 90: 87: 84: 81: 78: 73: 72: 69: 66: 63: 60: 57: 54: 6053: 6052: 6048: 6047: 6046: 6044: 6043: 6042: 6008: 6007: 6006: 6001: 5953: 5902: 5770: 5742: 5719: 5693:Retrotransposon 5674: 5665:Inverted repeat 5653: 5638:DNA transposon 5634:Retrotransposon 5629:Gene conversion 5620: 5613: 5610: 5561: 5552: 5535: 5505: 5500: 5468: 5442: 5383:Biopharmacology 5355: 5349: 5225: 5196:Electrophoresis 5191:Kidney dialysis 5181:Crystallization 5159: 5105: 5099: 5058: 5003: 4982: 4973: 4947: 4942: 4912: 4907: 4865: 4772: 4734: 4704: 4693:Paleopolyploidy 4638: 4632: 4488: 4462:Heterochromatin 4425: 4419: 4410: 4350: 4345: 4344: 4299: 4295: 4250:Ecology Letters 4242: 4238: 4193: 4189: 4120: 4116: 4055: 4051: 3998: 3994: 3969: 3965: 3926: 3922: 3907: 3903: 3864: 3860: 3813: 3809: 3756: 3752: 3709:Ding Z (2014). 3707: 3703: 3658: 3654: 3599: 3595: 3556: 3552: 3521:(12): 4611–27. 3507: 3503: 3449: 3442: 3397: 3393: 3356: 3352: 3299: 3295: 3256: 3252: 3207: 3203: 3155: 3149: 3145: 3098: 3094: 3047: 3043: 3012: 3008: 2977: 2973: 2934: 2930: 2877: 2873: 2842:(4): 130–1142. 2828: 2824: 2779: 2775: 2736: 2732: 2685: 2676: 2631: 2624: 2579: 2575: 2538:Biology Letters 2526: 2522: 2477: 2473: 2442:(19): 5402–15. 2428: 2424: 2379: 2375: 2328: 2324: 2287:(5973): 154–7. 2277: 2273: 2259: 2255: 2210: 2206: 2169: 2165: 2128: 2124: 2061: 2057: 2020:(5466): 665–9. 2010: 2006: 1961: 1957: 1926: 1922: 1881:(18): 7049–53. 1867: 1863: 1826: 1822: 1813: 1811: 1805: 1801: 1786: 1768: 1764: 1719: 1715: 1676: 1672: 1663: 1661: 1656: 1655: 1651: 1620: 1613: 1562: 1558: 1507: 1503: 1468: 1464: 1453: 1449: 1398: 1394: 1389: 1384: 1383: 1378: 1374: 1369: 1300: 1293: 1290: 1261: 1226: 1214:senescent cells 1206: 1202: 1197: 1191: 1188: 1145: 1134: 1130:primary sources 1114: 1110: 1103: 1053:Candida maltosa 997: 870:Cestrum elegans 632: 599:Michael D. West 571: 552: 544:life expectancy 527: 521: 497: 492: 463: 426: 412: 359: 345: 262: 260:DNA replication 256: 251: 217:Yale University 168: 152:chromosomal DNA 75: 51: 47: 28: 17: 12: 11: 5: 6051: 6041: 6040: 6038:Non-coding DNA 6035: 6030: 6025: 6020: 6003: 6002: 6000: 5999: 5994: 5989: 5984: 5979: 5978: 5977: 5972: 5965:Genomic island 5961: 5959: 5955: 5954: 5952: 5951: 5946: 5945: 5944: 5934: 5933: 5932: 5922: 5916: 5914: 5908: 5907: 5904: 5903: 5901: 5900: 5895: 5890: 5885: 5880: 5875: 5870: 5865: 5860: 5855: 5850: 5845: 5840: 5835: 5830: 5825: 5820: 5815: 5810: 5805: 5800: 5795: 5790: 5784: 5782: 5780:DNA transposon 5776: 5775: 5772: 5771: 5769: 5768: 5763: 5758: 5752: 5750: 5744: 5743: 5741: 5740: 5735: 5729: 5727: 5721: 5720: 5718: 5717: 5712: 5706: 5704: 5695: 5686: 5680: 5679: 5676: 5675: 5673: 5672: 5667: 5661: 5659: 5655: 5654: 5652: 5651: 5650: 5649: 5644: 5636: 5631: 5625: 5623: 5615: 5614: 5612: 5611: 5608:Macrosatellite 5605: 5595: 5586: 5580: 5578: 5576:Tandem repeats 5569: 5563: 5562: 5557: 5554: 5553: 5534: 5533: 5526: 5519: 5511: 5502: 5501: 5499: 5498: 5486: 5473: 5470: 5469: 5467: 5466: 5461: 5456: 5450: 5448: 5444: 5443: 5441: 5440: 5435: 5430: 5425: 5420: 5415: 5410: 5405: 5400: 5395: 5390: 5385: 5380: 5375: 5373:Bioengineering 5370: 5368:Bioelectronics 5365: 5359: 5357: 5351: 5350: 5348: 5347: 5345:Tissue culture 5342: 5337: 5332: 5327: 5322: 5317: 5312: 5311: 5310: 5305: 5295: 5290: 5285: 5284: 5283: 5278: 5268: 5263: 5258: 5253: 5251:Bioinformatics 5248: 5246:Biofabrication 5243: 5237: 5235: 5231: 5230: 5227: 5226: 5224: 5223: 5218: 5213: 5208: 5203: 5198: 5193: 5188: 5186:Chromatography 5183: 5178: 5173: 5171:Centrifugation 5167: 5165: 5164:Chemical field 5161: 5160: 5158: 5157: 5152: 5147: 5142: 5137: 5135:Flow cytometry 5132: 5127: 5122: 5116: 5114: 5107: 5101: 5100: 5098: 5097: 5092: 5087: 5082: 5077: 5072: 5066: 5064: 5060: 5059: 5057: 5056: 5051: 5046: 5041: 5036: 5031: 5022: 5017: 5011: 5009: 5005: 5004: 5002: 5001: 4996: 4990: 4988: 4984: 4983: 4976: 4974: 4972: 4971: 4966: 4961: 4955: 4953: 4949: 4948: 4941: 4940: 4933: 4926: 4918: 4909: 4908: 4906: 4905: 4900: 4895: 4890: 4889: 4888: 4877: 4875: 4871: 4870: 4867: 4866: 4864: 4863: 4858: 4853: 4848: 4843: 4838: 4833: 4828: 4823: 4818: 4813: 4808: 4803: 4798: 4793: 4788: 4782: 4780: 4774: 4773: 4771: 4770: 4765: 4760: 4755: 4750: 4744: 4742: 4733: 4732: 4727: 4712: 4710: 4706: 4705: 4703: 4702: 4697: 4696: 4695: 4690: 4685: 4680: 4670: 4669: 4668: 4663: 4653: 4648: 4642: 4640: 4634: 4633: 4631: 4630: 4629: 4628: 4623: 4618: 4613: 4603: 4602: 4601: 4596: 4591: 4586: 4584:Submetacentric 4581: 4571: 4566: 4561: 4556: 4551: 4546: 4541: 4536: 4531: 4525: 4516: 4511: 4510:or heterosome) 4504:Sex chromosome 4496: 4494: 4490: 4489: 4487: 4486: 4481: 4476: 4471: 4466: 4465: 4464: 4459: 4449: 4440: 4435: 4429: 4427: 4421: 4420: 4409: 4408: 4401: 4394: 4386: 4380: 4379: 4370: 4361: 4349: 4348:External links 4346: 4343: 4342: 4293: 4256:(2): 381–398. 4236: 4187: 4134:(11): 200548. 4114: 4049: 3992: 3963: 3920: 3901: 3874:(5): 2365–76. 3858: 3807: 3750: 3701: 3672:(10): 47e–47. 3652: 3593: 3550: 3501: 3464:(1): 420–433. 3440: 3391: 3350: 3293: 3250: 3201: 3166:(9): 2523–33. 3143: 3092: 3041: 3006: 2987:(3): 585–621. 2971: 2928: 2871: 2822: 2793:(11): 517–22. 2773: 2730: 2701:(2): 135–147. 2674: 2622: 2593:(7): 1637–43. 2573: 2520: 2471: 2422: 2373: 2322: 2271: 2253: 2204: 2163: 2136:Carcinogenesis 2122: 2055: 2004: 1955: 1920: 1861: 1820: 1799: 1784: 1762: 1713: 1670: 1649: 1611: 1576:(4): 443–448. 1556: 1521:(1): 181–190. 1501: 1462: 1447: 1391: 1390: 1388: 1385: 1382: 1381: 1371: 1370: 1368: 1365: 1364: 1363: 1358: 1353: 1348: 1343: 1337: 1332: 1327: 1322: 1317: 1312: 1306: 1305: 1302:Biology portal 1289: 1286: 1260: 1257: 1225: 1222: 1208: 1207: 1200: 1198: 1117: 1115: 1108: 1102: 1099: 1096: 1095: 1092: 1084: 1083: 1080: 1072: 1071: 1068: 1060: 1059: 1056: 1048: 1047: 1044: 1036: 1035: 1032: 1024: 1023: 1020: 1012: 1011: 1008: 1000: 999: 994: 987: 980: 979: 976: 969: 962: 961: 958: 951: 945: 944: 941: 933: 932: 929: 921: 920: 917: 910: 904: 903: 900: 889: 888: 885: 877: 876: 873: 865: 864: 861: 854: 847: 846: 843: 836: 829: 828: 825: 805: 804: 801: 793: 792: 789: 776: 769: 768: 765: 752: 745: 744: 741: 733: 732: 729: 716: 710: 709: 706: 699: 692: 691: 688: 673: 667: 666: 663: 660: 631: 628: 591:Hayflick limit 579:Hayflick limit 570: 567: 551: 548: 523:Main article: 520: 517: 496: 493: 491: 488: 462: 459: 441:, and certain 422:Main article: 411: 408: 396:G-quadruplexes 355:Main article: 344: 341: 274:DNA polymerase 258:Main article: 255: 252: 250: 247: 221:Joseph G. Gall 211:In 1975–1977, 167: 164: 15: 9: 6: 4: 3: 2: 6050: 6039: 6036: 6034: 6031: 6029: 6026: 6024: 6021: 6019: 6016: 6015: 6013: 5998: 5995: 5993: 5990: 5988: 5985: 5983: 5980: 5976: 5973: 5971: 5968: 5967: 5966: 5963: 5962: 5960: 5956: 5950: 5947: 5943: 5940: 5939: 5938: 5935: 5931: 5930:Ribosomal DNA 5928: 5927: 5926: 5923: 5921: 5918: 5917: 5915: 5913: 5909: 5899: 5896: 5894: 5891: 5889: 5886: 5884: 5881: 5879: 5876: 5874: 5871: 5869: 5866: 5864: 5861: 5859: 5856: 5854: 5851: 5849: 5846: 5844: 5841: 5839: 5836: 5834: 5831: 5829: 5826: 5824: 5821: 5819: 5816: 5814: 5811: 5809: 5806: 5804: 5801: 5799: 5796: 5794: 5791: 5789: 5786: 5785: 5783: 5781: 5777: 5767: 5764: 5762: 5759: 5757: 5754: 5753: 5751: 5749: 5745: 5739: 5736: 5734: 5731: 5730: 5728: 5726: 5722: 5716: 5713: 5711: 5708: 5707: 5705: 5703: 5699: 5696: 5694: 5690: 5687: 5685: 5681: 5671: 5670:Direct repeat 5668: 5666: 5663: 5662: 5660: 5656: 5648: 5645: 5643: 5640: 5639: 5637: 5635: 5632: 5630: 5627: 5626: 5624: 5622: 5616: 5609: 5606: 5603: 5599: 5596: 5594: 5593:Minisatellite 5590: 5587: 5585: 5584:Satellite DNA 5582: 5581: 5579: 5577: 5573: 5570: 5568: 5564: 5560: 5555: 5551: 5547: 5543: 5539: 5532: 5527: 5525: 5520: 5518: 5513: 5512: 5509: 5497: 5496: 5487: 5485: 5484: 5475: 5474: 5471: 5465: 5462: 5460: 5457: 5455: 5452: 5451: 5449: 5445: 5439: 5436: 5434: 5431: 5429: 5426: 5424: 5421: 5419: 5416: 5414: 5411: 5409: 5406: 5404: 5401: 5399: 5396: 5394: 5391: 5389: 5386: 5384: 5381: 5379: 5376: 5374: 5371: 5369: 5366: 5364: 5361: 5360: 5358: 5352: 5346: 5343: 5341: 5338: 5336: 5333: 5331: 5328: 5326: 5323: 5321: 5318: 5316: 5313: 5309: 5306: 5304: 5301: 5300: 5299: 5296: 5294: 5291: 5289: 5286: 5282: 5279: 5277: 5274: 5273: 5272: 5269: 5267: 5266:Cell immunity 5264: 5262: 5259: 5257: 5254: 5252: 5249: 5247: 5244: 5242: 5239: 5238: 5236: 5232: 5222: 5221:Sedimentation 5219: 5217: 5214: 5212: 5209: 5207: 5204: 5202: 5199: 5197: 5194: 5192: 5189: 5187: 5184: 5182: 5179: 5177: 5174: 5172: 5169: 5168: 5166: 5162: 5156: 5153: 5151: 5148: 5146: 5143: 5141: 5138: 5136: 5133: 5131: 5130:Cultured meat 5128: 5126: 5123: 5121: 5118: 5117: 5115: 5113:Biology field 5111: 5108: 5102: 5096: 5093: 5091: 5088: 5086: 5083: 5081: 5078: 5076: 5073: 5071: 5068: 5067: 5065: 5061: 5055: 5052: 5050: 5047: 5045: 5042: 5040: 5037: 5035: 5032: 5030: 5026: 5023: 5021: 5018: 5016: 5013: 5012: 5010: 5006: 5000: 4997: 4995: 4992: 4991: 4989: 4985: 4980: 4970: 4967: 4965: 4962: 4960: 4957: 4956: 4954: 4950: 4946: 4945:Biotechnology 4939: 4934: 4932: 4927: 4925: 4920: 4919: 4916: 4904: 4901: 4899: 4896: 4894: 4891: 4887: 4884: 4883: 4882: 4879: 4878: 4876: 4872: 4862: 4859: 4857: 4854: 4852: 4849: 4847: 4844: 4842: 4839: 4837: 4834: 4832: 4829: 4827: 4824: 4822: 4819: 4817: 4814: 4812: 4809: 4807: 4804: 4802: 4799: 4797: 4794: 4792: 4789: 4787: 4784: 4783: 4781: 4779: 4775: 4769: 4766: 4764: 4761: 4759: 4756: 4754: 4751: 4749: 4746: 4745: 4743: 4741: 4737: 4731: 4728: 4725: 4721: 4717: 4714: 4713: 4711: 4707: 4701: 4698: 4694: 4691: 4689: 4686: 4684: 4681: 4679: 4676: 4675: 4674: 4671: 4667: 4664: 4662: 4659: 4658: 4657: 4654: 4652: 4649: 4647: 4644: 4643: 4641: 4639:and evolution 4635: 4627: 4624: 4622: 4619: 4617: 4614: 4612: 4609: 4608: 4607: 4604: 4600: 4597: 4595: 4592: 4590: 4587: 4585: 4582: 4580: 4577: 4576: 4575: 4572: 4570: 4567: 4565: 4564:Isochromosome 4562: 4560: 4557: 4555: 4552: 4550: 4547: 4545: 4542: 4540: 4537: 4535: 4532: 4529: 4526: 4524: 4520: 4517: 4515: 4512: 4509: 4505: 4501: 4498: 4497: 4495: 4491: 4485: 4482: 4480: 4477: 4475: 4472: 4470: 4467: 4463: 4460: 4458: 4455: 4454: 4453: 4450: 4448: 4444: 4441: 4439: 4436: 4434: 4431: 4430: 4428: 4422: 4418: 4414: 4407: 4402: 4400: 4395: 4393: 4388: 4387: 4384: 4378: 4374: 4371: 4369: 4368:Carol Greider 4365: 4362: 4359: 4355: 4352: 4351: 4338: 4334: 4329: 4324: 4320: 4316: 4312: 4308: 4304: 4297: 4289: 4285: 4281: 4277: 4273: 4269: 4264: 4259: 4255: 4251: 4247: 4240: 4232: 4228: 4224: 4220: 4215: 4210: 4206: 4202: 4198: 4191: 4183: 4179: 4175: 4171: 4166: 4161: 4157: 4153: 4149: 4145: 4141: 4137: 4133: 4129: 4125: 4118: 4110: 4106: 4102: 4098: 4094: 4090: 4085: 4080: 4076: 4072: 4068: 4064: 4060: 4053: 4045: 4041: 4036: 4031: 4027: 4023: 4019: 4015: 4011: 4007: 4003: 3996: 3987: 3982: 3978: 3974: 3967: 3959: 3955: 3951: 3947: 3943: 3939: 3935: 3931: 3924: 3916: 3912: 3905: 3897: 3893: 3889: 3885: 3881: 3877: 3873: 3869: 3862: 3854: 3850: 3845: 3840: 3835: 3830: 3826: 3822: 3818: 3811: 3803: 3799: 3794: 3789: 3785: 3781: 3777: 3773: 3769: 3765: 3761: 3754: 3746: 3742: 3737: 3732: 3728: 3724: 3720: 3716: 3712: 3705: 3697: 3693: 3688: 3683: 3679: 3675: 3671: 3667: 3663: 3656: 3648: 3644: 3639: 3634: 3630: 3626: 3621: 3616: 3612: 3608: 3604: 3597: 3589: 3585: 3581: 3577: 3573: 3569: 3565: 3561: 3554: 3546: 3542: 3537: 3532: 3528: 3524: 3520: 3516: 3512: 3505: 3497: 3493: 3488: 3483: 3479: 3475: 3471: 3467: 3463: 3459: 3455: 3447: 3445: 3436: 3432: 3428: 3424: 3419: 3414: 3411:(3): 337–47. 3410: 3406: 3402: 3395: 3387: 3383: 3378: 3373: 3370:(4): 644–54. 3369: 3365: 3361: 3354: 3346: 3342: 3337: 3332: 3328: 3324: 3320: 3316: 3312: 3308: 3304: 3297: 3289: 3285: 3281: 3277: 3273: 3269: 3265: 3261: 3254: 3246: 3242: 3237: 3232: 3228: 3224: 3220: 3216: 3212: 3205: 3197: 3193: 3189: 3185: 3181: 3177: 3173: 3169: 3165: 3161: 3154: 3147: 3139: 3135: 3131: 3127: 3123: 3119: 3115: 3111: 3107: 3103: 3096: 3088: 3084: 3080: 3076: 3072: 3068: 3064: 3060: 3056: 3052: 3045: 3037: 3033: 3029: 3025: 3022:(3): 614–36. 3021: 3017: 3010: 3002: 2998: 2994: 2990: 2986: 2982: 2975: 2967: 2963: 2959: 2955: 2951: 2947: 2943: 2939: 2932: 2924: 2920: 2915: 2910: 2906: 2902: 2898: 2894: 2891:(8): 180744. 2890: 2886: 2882: 2875: 2867: 2863: 2858: 2853: 2849: 2845: 2841: 2837: 2833: 2826: 2818: 2814: 2809: 2804: 2800: 2796: 2792: 2788: 2784: 2777: 2769: 2765: 2760: 2755: 2751: 2747: 2746: 2741: 2734: 2726: 2722: 2717: 2712: 2708: 2704: 2700: 2696: 2695: 2690: 2683: 2681: 2679: 2670: 2666: 2661: 2656: 2652: 2648: 2644: 2640: 2636: 2629: 2627: 2618: 2614: 2609: 2604: 2600: 2596: 2592: 2588: 2584: 2577: 2569: 2565: 2560: 2555: 2551: 2547: 2543: 2539: 2535: 2533: 2524: 2516: 2512: 2507: 2502: 2498: 2494: 2490: 2486: 2482: 2475: 2467: 2463: 2458: 2453: 2449: 2445: 2441: 2437: 2433: 2426: 2418: 2414: 2410: 2406: 2401: 2396: 2393:(4): 503–14. 2392: 2388: 2384: 2377: 2369: 2365: 2360: 2355: 2350: 2345: 2341: 2337: 2333: 2326: 2318: 2314: 2310: 2306: 2302: 2298: 2294: 2290: 2286: 2282: 2275: 2269: 2265: 2264: 2257: 2249: 2245: 2241: 2237: 2232: 2227: 2223: 2219: 2215: 2208: 2200: 2196: 2191: 2186: 2182: 2178: 2174: 2167: 2159: 2155: 2150: 2145: 2142:(5): 867–74. 2141: 2137: 2133: 2126: 2118: 2114: 2109: 2104: 2100: 2096: 2091: 2086: 2082: 2078: 2074: 2070: 2066: 2059: 2051: 2047: 2043: 2039: 2035: 2031: 2027: 2023: 2019: 2015: 2008: 2000: 1996: 1991: 1986: 1982: 1978: 1975:(22): e1657. 1974: 1970: 1966: 1959: 1951: 1947: 1943: 1939: 1936:(8): 414–22. 1935: 1931: 1924: 1916: 1912: 1907: 1902: 1897: 1892: 1888: 1884: 1880: 1876: 1872: 1865: 1857: 1853: 1848: 1843: 1840:(5): 653–66. 1839: 1835: 1831: 1824: 1810: 1803: 1795: 1791: 1787: 1785:9780716771081 1781: 1776: 1775: 1766: 1758: 1754: 1749: 1744: 1740: 1736: 1732: 1728: 1724: 1717: 1709: 1705: 1701: 1697: 1693: 1689: 1686:(1): 181–90. 1685: 1681: 1674: 1659: 1653: 1645: 1641: 1637: 1633: 1629: 1625: 1618: 1616: 1607: 1603: 1599: 1595: 1591: 1587: 1583: 1579: 1575: 1571: 1567: 1560: 1552: 1548: 1544: 1540: 1536: 1532: 1528: 1524: 1520: 1516: 1512: 1505: 1497: 1493: 1489: 1485: 1481: 1477: 1473: 1466: 1458: 1451: 1443: 1439: 1435: 1431: 1427: 1423: 1419: 1415: 1411: 1407: 1403: 1396: 1392: 1376: 1372: 1362: 1359: 1357: 1354: 1352: 1349: 1347: 1344: 1341: 1338: 1336: 1333: 1331: 1328: 1326: 1323: 1321: 1318: 1316: 1313: 1311: 1308: 1307: 1303: 1297: 1292: 1285: 1283: 1279: 1274: 1271: 1267: 1256: 1254: 1249: 1247: 1243: 1238: 1236: 1232: 1221: 1219: 1215: 1199: 1195: 1184: 1181: 1177: 1174: 1170: 1167: 1163: 1160: 1156: 1153: –  1152: 1148: 1147:Find sources: 1142: 1138: 1132: 1131: 1127: 1123: 1118:This section 1116: 1107: 1106: 1093: 1091: 1090: 1086: 1085: 1081: 1079: 1078: 1074: 1073: 1069: 1067: 1066: 1062: 1061: 1057: 1055: 1054: 1050: 1049: 1045: 1043: 1042: 1038: 1037: 1033: 1031: 1030: 1026: 1025: 1021: 1019: 1018: 1014: 1013: 1009: 1007: 1006: 1002: 1001: 995: 993: 992: 988: 986: 981: 977: 975: 974: 970: 968: 964: 963: 959: 957: 956: 952: 950: 947: 946: 942: 940: 939: 935: 934: 930: 928: 927: 923: 922: 918: 916: 915: 911: 909: 905: 901: 899: 898: 897:Chlamydomonas 894: 891: 890: 887:CTCGGTTATGGG 886: 884: 883: 879: 878: 874: 872: 871: 867: 866: 862: 860: 859: 855: 853: 848: 844: 842: 841: 837: 834: 831: 830: 826: 824: 823: 818: 817: 812: 811: 807: 806: 802: 800: 799: 795: 794: 790: 788: 787: 782: 781: 777: 774: 770: 766: 764: 763: 758: 757: 753: 750: 749:Kinetoplastid 747: 746: 742: 740: 739: 738:Dictyostelium 735: 734: 730: 728: 727: 722: 721: 717: 715: 711: 707: 705: 704: 700: 698: 694: 693: 689: 687: 686: 681: 677: 674: 672: 669: 668: 664: 661: 658: 657: 651: 649: 646:website (see 645: 641: 637: 627: 623: 621: 617: 613: 608: 606: 605: 600: 596: 592: 588: 580: 575: 566: 564: 560: 556: 555:Meta-analyses 547: 545: 539: 537: 534:response and 533: 526: 516: 514: 510: 506: 502: 487: 485: 481: 476: 472: 468: 458: 456: 452: 448: 444: 440: 436: 432: 425: 416: 407: 405: 401: 397: 393: 389: 385: 381: 377: 373: 369: 365: 358: 349: 340: 338: 334: 333: 328: 327: 326:Agrobacterium 322: 321: 316: 312: 307: 303: 301: 300:cell division 297: 293: 289: 284: 279: 275: 266: 261: 246: 244: 241: 237: 234: 230: 226: 225:Carol Greider 222: 218: 214: 209: 206: 202: 198: 193: 191: 187: 183: 179: 178: 173: 163: 161: 157: 153: 149: 145: 141: 137: 133: 130: 123: 119: 116: 113: 106: 102: 99: 98:Ancient Greek 93: 45: 37: 32: 26: 22: 5991: 5942:Gene cluster 5710:Alu sequence 5619:Interspersed 5493: 5481: 5418:Microbiology 5403:Biochemicals 5339: 5315:Gene therapy 5256:Biosynthesis 5234:Applications 5155:Spectroscopy 5125:Cell culture 5034:Fermentation 4715: 4605: 4573: 4413:Cytogenetics 4377:Jack Szostak 4310: 4306: 4296: 4253: 4249: 4239: 4204: 4200: 4190: 4131: 4127: 4117: 4066: 4062: 4052: 4009: 4005: 3995: 3976: 3966: 3933: 3929: 3923: 3914: 3904: 3871: 3867: 3861: 3824: 3820: 3810: 3767: 3763: 3753: 3718: 3714: 3704: 3669: 3665: 3655: 3610: 3606: 3596: 3566:(8): 743–7. 3563: 3559: 3553: 3518: 3514: 3504: 3461: 3457: 3408: 3404: 3394: 3367: 3363: 3353: 3310: 3306: 3296: 3263: 3259: 3253: 3221:(5): 761–8. 3218: 3214: 3204: 3163: 3159: 3146: 3105: 3101: 3095: 3054: 3050: 3044: 3019: 3015: 3009: 2984: 2980: 2974: 2941: 2937: 2931: 2888: 2884: 2874: 2839: 2835: 2825: 2790: 2786: 2776: 2749: 2743: 2733: 2698: 2692: 2642: 2638: 2590: 2586: 2576: 2541: 2537: 2531: 2523: 2488: 2484: 2474: 2439: 2435: 2425: 2390: 2386: 2376: 2339: 2335: 2325: 2284: 2280: 2274: 2261: 2256: 2224:(8): 363–9. 2221: 2217: 2207: 2180: 2176: 2166: 2139: 2135: 2125: 2072: 2068: 2058: 2017: 2013: 2007: 1972: 1969:Bio-Protocol 1968: 1958: 1933: 1929: 1923: 1878: 1874: 1864: 1837: 1833: 1823: 1812:. Retrieved 1802: 1773: 1765: 1730: 1726: 1716: 1683: 1679: 1673: 1662:. Retrieved 1652: 1630:(1): 33–53. 1627: 1623: 1573: 1569: 1559: 1518: 1514: 1504: 1479: 1475: 1465: 1456: 1450: 1409: 1405: 1395: 1375: 1275: 1270:heritability 1262: 1250: 1239: 1227: 1211: 1189: 1179: 1172: 1165: 1158: 1146: 1126:verification 1119: 1087: 1075: 1063: 1051: 1039: 1027: 1015: 1003: 989: 971: 953: 943:TTGCGTCTGGG 936: 931:TTAGGTTGGGG 924: 912: 895: 880: 868: 856: 845:TTAGGG(T/C) 838: 833:Apicomplexan 820: 814: 808: 796: 784: 778: 760: 754: 736: 724: 718: 714:Slime moulds 701: 695:Filamentous 683: 633: 624: 619: 609: 602: 584: 553: 540: 528: 498: 464: 427: 360: 330: 324: 320:Streptomyces 318: 308: 304: 271: 229:Jack Szostak 210: 205:somatic cell 194: 189: 185: 175: 169: 128: 125: 118: 111: 108: 101: 96:; from 43: 41: 6018:Chromosomes 5937:Gene family 5848:Tc1/mariner 5803:EnSpm/CACTA 5408:Biorobotics 5398:Biomimetics 5393:Biomedicine 4626:Polycentric 4616:Monocentric 4599:Holocentric 4594:Acrocentric 4589:Telocentric 4579:Metacentric 4457:Euchromatin 4417:chromosomes 3770:(1): 1300. 2944:: 223–245. 2645:: 158–169. 2534:? A review" 1325:Immortality 1276:Studies on 1259:In wildlife 1224:Measurement 1216:, or SASP ( 1120:needs more 914:Bombyx mori 893:Green algae 875:TTTTTTAGGG 816:Stylonychia 803:TTGGG(T/G) 780:Tetrahymena 756:Trypanosoma 671:Vertebrates 569:Lengthening 486:or D-loop. 404:vertebrates 392:vertebrates 311:prokaryotes 140:chromosomes 36:chromosomes 6012:Categories 5949:Pseudogene 5766:retroposon 5684:Transposon 5546:transposon 5363:Bioeconomy 5335:Stem cells 5288:Embryology 5211:Filtration 5201:Extraction 5120:Bioreactor 4778:Centromere 4709:Structures 4688:Polyploidy 4678:Aneuploidy 4479:Nucleosome 4469:Chromosome 3827:(1): 272. 3721:(9): e75. 3613:(1): 145. 3215:Aging Cell 1834:Aging Cell 1814:2008-06-22 1664:2012-06-12 1387:References 1340:Senescence 1315:Centromere 1278:ectotherms 1266:endotherms 1192:March 2018 1162:newspapers 1151:"Telomere" 949:Roundworms 840:Plasmodium 798:Paramecium 640:nucleotide 532:DNA damage 490:Shortening 467:base pairs 451:senescence 435:stem cells 431:germ cells 424:Telomerase 410:Telomerase 296:base pairs 243:telomerase 188:(end) and 156:DNA repair 148:eukaryotes 136:nucleotide 6033:Telomeres 5868:P element 5818:Harbinger 5559:Repeatome 5206:Fed Batch 5106:and tools 4730:Protamine 4637:Processes 4621:Dicentric 4474:Chromatid 4452:Chromatin 4433:Karyotype 4288:208319503 4272:1461-023X 4223:0962-1083 4182:226291119 4156:2054-5703 4109:237328316 4093:0962-1083 4026:0962-8436 3936:: e1727. 3629:1471-2105 3478:0305-1048 3435:206331112 3327:0305-1048 2966:209748557 2491:: 37–45. 2218:BioEssays 2183:(3): 19. 2177:MedGenMed 2099:0027-8424 1794:191854286 1590:0531-5565 1543:0022-5193 1488:0002-3264 1426:1476-5594 1356:G-quartet 1346:Tankyrase 1246:Flow-FISH 1010:TCTGGGTG 902:TTTTAGGG 835:protozoa 827:TTTTGGGG 810:Oxytricha 775:protozoa 762:Crithidia 751:protozoa 662:Organism 630:Sequences 357:Shelterin 315:bacterial 166:Discovery 144:Sequences 5992:Telomere 5958:See also 5898:Zisupton 5878:Polinton 5873:PiggyBac 5828:Helitron 5647:Helitron 5642:Polinton 5538:Genetics 5483:Category 5438:Virology 5340:Telomere 4987:Branches 4874:See also 4716:Telomere 4683:Euploidy 4611:Acentric 4508:allosome 4500:Autosome 4426:concepts 4337:29335373 4280:31773847 4231:33662151 4174:33391781 4101:34437736 4044:29335377 3958:44594597 3950:22415954 3896:20463557 3888:17406480 3853:31138115 3802:29358629 3745:24609383 3696:12000852 3647:33752601 3588:23833545 3496:36546771 3427:26716914 3386:25828846 3345:37602392 3336:10767889 3288:10309423 3280:21194798 3245:21518243 3196:13841086 3188:15315667 3138:35667874 3036:14315085 3001:13905658 2958:31900099 2923:30225068 2866:28394764 2817:22782639 2768:33504179 2725:35165420 2669:26853993 2617:19089916 2568:29212750 2515:29604323 2466:17012276 2409:10338214 2368:20826803 2248:11920124 2199:15520642 2158:15471900 2117:31285335 2050:37387314 2042:10784448 1999:27182535 1950:19589679 1856:20569239 1757:22661228 1606:26381790 1442:11726588 1434:20237481 1406:Oncogene 1288:See also 1070:GGTGTAC 983:Budding 965:Fission 863:TTTAGGG 822:Euplotes 786:Glaucoma 743:AG(1-8) 726:Didymium 720:Physarum 636:TeloBase 612:seabirds 501:in vitro 437:such as 400:ciliates 337:proteins 332:Borrelia 192:(part). 44:telomere 5888:Transib 5863:Novosib 5843:Kolobok 5813:Ginger2 5808:Ginger1 5793:Crypton 5495:Commons 5378:Biology 5271:Cloning 5049:Protein 5044:Plasmid 4952:History 4886:Plasmid 4740:Histone 4651:Meiosis 4646:Mitosis 4328:5784069 4165:7735339 4136:Bibcode 4035:5784070 3844:6540518 3793:5778012 3772:Bibcode 3736:4027178 3638:7986547 3580:9702772 3545:2664709 3487:9841428 3236:3387546 3168:Bibcode 3130:9454332 3110:Bibcode 3102:Science 3087:9440710 3079:7544491 3059:Bibcode 3051:Science 2914:6124068 2893:Bibcode 2857:5425118 2808:3480822 2716:8985209 2660:5590630 2608:2727686 2559:5746531 2532:in vivo 2506:6162185 2457:1636468 2359:2975205 2317:4360698 2309:6330571 2289:Bibcode 2240:2241933 2190:1435592 2108:6660761 2077:Bibcode 2022:Bibcode 2014:Science 1990:4863463 1915:2780561 1883:Bibcode 1748:3371406 1708:4754905 1688:Bibcode 1598:9415101 1551:4754905 1523:Bibcode 1496:5158754 1282:Metazoa 1176:scholar 1141:removed 960:TTAGGC 908:Insects 850:Higher 791:TTGGGG 773:Ciliate 767:TTAGGG 731:TTAGGG 708:TTAGGG 690:TTAGGG 685:Xenopus 604:Science 509:in vivo 471:guanine 388:guanine 278:3' ends 5987:CRISPR 5853:Merlin 5838:ISL2EU 5788:Academ 5621:repeat 5423:Mining 5356:fields 5015:Allele 4447:Genome 4438:Ploidy 4335:  4325:  4286:  4278:  4270:  4229:  4221:  4180:  4172:  4162:  4154:  4107:  4099:  4091:  4042:  4032:  4024:  3977:Nature 3956:  3948:  3894:  3886:  3851:  3841:  3800:  3790:  3743:  3733:  3694:  3687:115301 3684:  3645:  3635:  3627:  3586:  3578:  3543:  3536:318019 3533:  3494:  3484:  3476:  3433:  3425:  3384:  3343:  3333:  3325:  3286:  3278:  3243:  3233:  3194:  3186:  3136:  3128:  3085:  3077:  3034:  2999:  2964:  2956:  2921:  2911:  2864:  2854:  2815:  2805:  2766:  2723:  2713:  2667:  2657:  2615:  2605:  2566:  2556:  2513:  2503:  2464:  2454:  2417:721901 2415:  2407:  2366:  2356:  2315:  2307:  2281:Nature 2246:  2238:  2197:  2187:  2156:  2115:  2105:  2097:  2048:  2040:  1997:  1987:  1948:  1913:  1906:297991 1903:  1854:  1792:  1782:  1755:  1745:  1706:  1644:642006 1642:  1604:  1596:  1588:  1549:  1541:  1494:  1486:  1440:  1432:  1424:  1231:WALTER 1178:  1171:  1164:  1157:  1149:  985:yeasts 967:yeasts 919:TTAGG 882:Allium 852:plants 659:Group 461:Length 455:cancer 382:, and 329:, and 283:primer 240:enzyme 227:, and 34:Human 5893:Zator 5833:IS3EU 5738:LINE2 5733:LINE1 5725:LINEs 5702:SINEs 5658:Other 5447:Lists 5325:Omics 4724:TINF2 4493:Types 4424:Basic 4284:S2CID 4178:S2CID 4105:S2CID 3954:S2CID 3892:S2CID 3584:S2CID 3431:S2CID 3284:S2CID 3192:S2CID 3156:(PDF) 3134:S2CID 3083:S2CID 2962:S2CID 2836:Aging 2413:S2CID 2313:S2CID 2244:S2CID 2046:S2CID 1602:S2CID 1438:S2CID 1367:Notes 1183:JSTOR 1169:books 697:fungi 680:mouse 676:Human 219:with 190:meros 186:telos 142:(see 129:méros 122:μέρος 112:télos 105:τέλος 100: 5883:Sola 5858:MuDR 5798:Dada 5761:MER4 5756:HERV 5748:LTRs 5176:CSTR 5145:HPLC 5039:Gene 5020:Cell 4506:(or 4333:PMID 4276:PMID 4268:ISSN 4227:PMID 4219:ISSN 4170:PMID 4152:ISSN 4097:PMID 4089:ISSN 4040:PMID 4022:ISSN 3946:PMID 3884:PMID 3849:PMID 3798:PMID 3741:PMID 3692:PMID 3643:PMID 3625:ISSN 3576:PMID 3541:PMID 3492:PMID 3474:ISSN 3423:PMID 3382:PMID 3341:PMID 3323:ISSN 3276:PMID 3241:PMID 3184:PMID 3126:PMID 3075:PMID 3032:PMID 2997:PMID 2954:PMID 2919:PMID 2862:PMID 2813:PMID 2764:PMID 2721:PMID 2665:PMID 2613:PMID 2564:PMID 2511:PMID 2462:PMID 2405:PMID 2387:Cell 2364:PMID 2305:PMID 2236:PMID 2195:PMID 2154:PMID 2113:PMID 2095:ISSN 2038:PMID 1995:PMID 1946:PMID 1911:PMID 1852:PMID 1790:OCLC 1780:ISBN 1753:PMID 1704:PMID 1640:PMID 1594:PMID 1586:ISSN 1547:PMID 1539:ISSN 1492:PMID 1484:ISSN 1430:PMID 1422:ISSN 1155:news 1124:for 384:RAP1 380:TPP1 376:POT1 372:TIN2 368:TRF2 364:TRF1 298:per 233:2009 5823:hAT 5715:MIR 5216:PFR 5150:NMR 5029:RNA 5025:DNA 4758:H2B 4753:H2A 4323:PMC 4315:doi 4311:373 4258:doi 4209:doi 4160:PMC 4144:doi 4079:hdl 4071:doi 4030:PMC 4014:doi 4010:373 3981:doi 3938:doi 3934:344 3930:BMJ 3876:doi 3839:PMC 3829:doi 3788:PMC 3780:doi 3731:PMC 3723:doi 3682:PMC 3674:doi 3633:PMC 3615:doi 3568:doi 3531:PMC 3523:doi 3482:PMC 3466:doi 3413:doi 3372:doi 3331:PMC 3315:doi 3268:doi 3231:PMC 3223:doi 3176:doi 3118:doi 3106:279 3067:doi 3055:269 3024:doi 2989:doi 2946:doi 2909:PMC 2901:doi 2852:PMC 2844:doi 2803:PMC 2795:doi 2754:doi 2711:PMC 2703:doi 2655:PMC 2647:doi 2603:PMC 2595:doi 2591:124 2554:PMC 2546:doi 2501:PMC 2493:doi 2489:177 2452:PMC 2444:doi 2395:doi 2354:PMC 2344:doi 2340:285 2297:doi 2285:310 2226:doi 2185:PMC 2144:doi 2103:PMC 2085:doi 2073:116 2030:doi 2018:288 1985:PMC 1977:doi 1938:doi 1901:PMC 1891:doi 1842:doi 1743:PMC 1735:doi 1696:doi 1632:doi 1628:120 1578:doi 1531:doi 1480:201 1414:doi 1235:PCR 1220:). 288:RNA 71:ɪər 6014:: 5548:, 5544:, 5540:: 4801:C2 4796:C1 4768:H4 4763:H3 4748:H1 4718:: 4415:: 4331:. 4321:. 4309:. 4305:. 4282:. 4274:. 4266:. 4254:23 4252:. 4248:. 4225:. 4217:. 4205:31 4203:. 4199:. 4176:. 4168:. 4158:. 4150:. 4142:. 4130:. 4126:. 4103:. 4095:. 4087:. 4077:. 4067:31 4065:. 4061:. 4038:. 4028:. 4020:. 4008:. 4004:. 3979:. 3975:. 3952:. 3944:. 3932:. 3913:. 3890:. 3882:. 3870:. 3847:. 3837:. 3825:20 3823:. 3819:. 3796:. 3786:. 3778:. 3766:. 3762:. 3739:. 3729:. 3719:42 3717:. 3713:. 3690:. 3680:. 3670:30 3668:. 3664:. 3641:. 3631:. 3623:. 3611:22 3609:. 3605:. 3582:. 3574:. 3564:16 3562:. 3539:. 3529:. 3519:17 3517:. 3513:. 3490:. 3480:. 3472:. 3462:51 3460:. 3456:. 3443:^ 3429:. 3421:. 3409:85 3407:. 3403:. 3380:. 3368:82 3366:. 3362:. 3339:. 3329:. 3321:. 3311:52 3309:. 3305:. 3282:. 3274:. 3264:33 3262:. 3239:. 3229:. 3219:10 3217:. 3213:. 3190:. 3182:. 3174:. 3164:13 3162:. 3158:. 3132:. 3124:. 3116:. 3104:. 3081:. 3073:. 3065:. 3053:. 3030:. 3020:37 3018:. 2995:. 2985:25 2983:. 2960:. 2952:. 2942:41 2940:. 2917:. 2907:. 2899:. 2887:. 2883:. 2860:. 2850:. 2838:. 2834:. 2811:. 2801:. 2791:18 2789:. 2785:. 2762:. 2750:41 2748:. 2742:. 2719:. 2709:. 2699:24 2697:. 2691:. 2677:^ 2663:. 2653:. 2643:54 2641:. 2637:. 2625:^ 2611:. 2601:. 2589:. 2585:. 2562:. 2552:. 2542:13 2540:. 2536:. 2509:. 2499:. 2487:. 2483:. 2460:. 2450:. 2440:34 2438:. 2434:. 2411:. 2403:. 2391:97 2389:. 2385:. 2362:. 2352:. 2338:. 2334:. 2311:. 2303:. 2295:. 2283:. 2242:. 2234:. 2222:12 2220:. 2216:. 2193:. 2179:. 2175:. 2152:. 2140:26 2138:. 2134:. 2111:. 2101:. 2093:. 2083:. 2071:. 2067:. 2044:. 2036:. 2028:. 2016:. 1993:. 1983:. 1971:. 1967:. 1944:. 1934:19 1932:. 1909:. 1899:. 1889:. 1879:86 1877:. 1873:. 1850:. 1836:. 1832:. 1788:. 1751:. 1741:. 1731:26 1729:. 1725:. 1702:. 1694:. 1684:41 1682:. 1638:. 1626:. 1614:^ 1600:. 1592:. 1584:. 1574:31 1572:. 1568:. 1545:. 1537:. 1529:. 1519:41 1517:. 1513:. 1490:. 1478:. 1474:. 1436:. 1428:. 1420:. 1410:29 1408:. 1404:. 1143:. 819:, 813:, 783:, 759:, 723:, 682:, 678:, 378:, 374:, 370:, 366:, 323:, 302:. 245:. 162:. 92:-/ 83:iː 42:A 5604:) 5600:( 5591:/ 5530:e 5523:t 5516:v 5027:/ 4937:e 4930:t 4923:v 4861:T 4856:Q 4851:P 4846:O 4841:N 4836:M 4831:K 4826:J 4821:I 4816:H 4811:F 4806:E 4791:B 4786:A 4726:) 4722:( 4521:/ 4502:/ 4445:/ 4405:e 4398:t 4391:v 4339:. 4317:: 4290:. 4260:: 4233:. 4211:: 4184:. 4146:: 4138:: 4132:7 4111:. 4081:: 4073:: 4046:. 4016:: 3989:. 3983:: 3960:. 3940:: 3917:. 3898:. 3878:: 3872:1 3855:. 3831:: 3804:. 3782:: 3774:: 3768:8 3747:. 3725:: 3698:. 3676:: 3649:. 3617:: 3590:. 3570:: 3547:. 3525:: 3498:. 3468:: 3437:. 3415:: 3388:. 3374:: 3347:. 3317:: 3290:. 3270:: 3247:. 3225:: 3198:. 3178:: 3170:: 3140:. 3120:: 3112:: 3089:. 3069:: 3061:: 3038:. 3026:: 3003:. 2991:: 2968:. 2948:: 2925:. 2903:: 2895:: 2889:5 2868:. 2846:: 2840:9 2819:. 2797:: 2770:. 2756:: 2727:. 2705:: 2671:. 2649:: 2619:. 2597:: 2570:. 2548:: 2517:. 2495:: 2468:. 2446:: 2419:. 2397:: 2370:. 2346:: 2319:. 2299:: 2291:: 2250:. 2228:: 2201:. 2181:6 2160:. 2146:: 2119:. 2087:: 2079:: 2052:. 2032:: 2024:: 2001:. 1979:: 1973:5 1952:. 1940:: 1917:. 1893:: 1885:: 1858:. 1844:: 1838:9 1817:. 1796:. 1759:. 1737:: 1710:. 1698:: 1690:: 1667:. 1646:. 1634:: 1608:. 1580:: 1553:. 1533:: 1525:: 1498:. 1444:. 1416:: 1229:( 1194:) 1190:( 1180:· 1173:· 1166:· 1159:· 1133:. 618:( 132:) 126:( 115:) 109:( 89:ə 86:l 80:t 77:ˈ 74:, 68:m 65:ə 62:l 59:ɛ 56:t 53:ˈ 50:/ 46:( 27:.

Index

Telomere (insect morphology)
Telomere (disambiguation)

chromosomes
/ˈtɛləmɪər,ˈtlə-/
Ancient Greek
τέλος
μέρος
nucleotide
chromosomes
Sequences
eukaryotes
chromosomal DNA
DNA repair
double-strand break
Hermann Joseph Muller
Drosophila melanogaster
Barbara McClintock
Alexey Olovnikov
Leonard Hayflick
somatic cell
Elizabeth Blackburn
Yale University
Joseph G. Gall
Carol Greider
Jack Szostak
2009
Nobel Prize in Physiology or Medicine
enzyme
telomerase

Text is available under the Creative Commons Attribution-ShareAlike License. Additional terms may apply.