Haplogroup Q-M242 - Knowledge

1515:

Asians. It is not found in South east Asia except with low diversity in Y-STR among southern Han Chinese indicating it spread during the Neolithic with Han Chinese culture to southern China from northern China. Q1a3*-M346 is only found among Hui and southern Han Chinese in South East Asia in southern China but not found in non-Han indigenous peoples at all. It came from northern China (north east Asia) with the Han. Only Native Americans have Q1a3a-M3, which is a descendant haplogroup of Q1a3*-M346. The Americas was populated by migrants from Central Asia in prehistoric times. Q1a1 is attested in over 3,000 year old Han Chinese ancestral remains in the Shang and Zhou dynasties from the Hengbei archeological site. Modern northern Han Chinese Y haplogroups and mtdna match those of ancient northern Han Chinese ancestors 3,000 years ago from the Hengbei archeological site. 89 ancient samples were taken. Y haplogroups O3a, O3a3, M, O2a, Q1a1, and O* were all found in Hengbei samples.

1522:: 15.38% (22/143, including 6/143 Q-M378, 5/143 Q-P36.2*, 4/143 Q-M120, 4/143 Q-M346, 1/143 Q-M25) of a sample of Uyghurs from the Turpan area (吐鲁番地区), 7.9% (6/76, including 2/76 Q1b1-L215/Page82/S325, 1/76 Q1a2-M346*, 1/76 Q1a1a1-M120, 1/76 Q1a2a1c-L330*, 1/76 Q1a2a1c1-L332) of a sample of Dolan Uyghurs (刀郎人) from Horiqol Township of Awat County, and 7.74% (37/478, including 24/478 Q-M346, 7/478 Q-P36.2*, 5/478 Q-M120) of a sample of Uyghurs from the Hotan area (和田地区). However, other studies have found haplogroup Q in much smaller percentages of Uyghur samples: 3.0% (2/67) Q-P36 Uygur, 1.6% (1/64) Q-M120 Lop Uyghur (罗布人). Haplogroup Q was not observed in a sample of 39 Keriyan Uyghurs (克里雅人) from the village of Darya Boyi, located on the Keriya River deep in the Taklamakan Desert. 47: 3139: 1510:. The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China. In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China. In another study published in 2011, Hua Zhong 1307:) in eastern Tuva show the frequency at ≤22.2% (8/36 P(xR1))~38.5% (10/26, all Q-M346(xM3)). So, the average frequency of Q-M242 among Tuvans-Todjins in Tuva Republic is about 25%. Haplogroup Q-M242 has been found in 5.9% (3/51) of a sample of Tuvans from the village of Kanasi, 9.8% (5/51) of a sample of Tuvans from the village of Hemu, and 62.5% (30/48) of a sample of Tuvans from the village of Baihaba in northern 5471:

found in far east Siberia. Thus, P-M45 except some samples mentioned above virtually means Q-M242 (xM3). In the paper, 35.3% of Nivkhs and 20.8% of Chukchi people and 18.2% of Siberian Eskimos are shown in P-M45, and 12.5% of Chukchis and 21.2% of Siberian Eskimos are in Q-M3. All of them can be estimated to be in haplogroup Q.

7815:

The frequency of Q is 4% (6/150, all Q-M25) in Regueiro 2006, in which it is 9.1% (3/33) in north Iran and 2.6% (3/117) in south Iran. But, since more people live in the northern regions, if recalculated by population weights, the frequency will reach about 6%. It is also 6.2% (35/566) in Bekada 2013

7524:

Haber, Marc; Platt, Daniel E.; Ashrafian Bonab, Maziar; Youhanna, Sonia C.; Soria-Hernanz, David F.; Martínez-Cruz, Begoña; Douaihy, Bouchra; Ghassibe-Sabbagh, Michella; Rafatpanah, Hoshang; Ghanbari, Mohsen; Whale, John; Balanovsky, Oleg; Wells, R. Spencer; Comas, David; Tyler-Smith, Chris; Zalloua,

2821:

In another paper, the social status of those human remains of ancient Peng kingdom(倗国) are analyzed. aristocrats: 3 Q1a1 (prostrate 2, supine 1), 2 O3a (supine 2), 1 N (prostrate) / commoners : 8 Q1a1 (prostrate 4, supine 4), 3 O3a (prostrate 1, supine 2), 3 O* (supine 3) / slaves: 3 O3a, 2 O2a,

7421:

E. E. Ashirbekov, D. M. Botbaev, A. M. Belkozhaev, A. O. Abayldaev, A. S. Neupokoeva, J. E. Mukhataev, B. Alzhanuly, D. A. Sharafutdinova, D. D. Mukushkina, M. B. Rakhymgozhin, A. K. Khanseitova, S. A. Limborska, and N. A. Aytkhozhina, "Distribution of Y-Chromosome Haplogroups of the Kazakh from the

1284:

and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples. In another study, the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of

1514:

found haplogroup Q-M242 in 3.99% (34/853, including 30/853 Q-M120, 3/853 Q-M346, and 1/853 Q-M25) of a pool of samples of Han Chinese from northern China and 1.71% (15/876, including 14/876 Q-M120 and 1/876 Q-M346) of a pool of samples of Han Chinese from southern China. Q1a1-M120 is unique to East

314:

has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration

5204:=> (DANE, 2006) 86% of the whole Colombian population self-reported as of Mixed Ancestry, 3.4% as Native American, 10.5% as African-Columbian. In this paper, 12% (114/954) of MA, 95.7% (135/141) of NA, and 23.8% (5/21) of AC are turned out to be Y-DNA Q. Thus, 86*0.12+3.4*0.957+10.5*0.238=16.1% 1830:

Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in

5470:

The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups in the paper, R1-M173 is harbored only in some eastern Siberian Udegeys and Koryaks and Native Americans. Also, R2 (distributed in India and its neighbours) cannot be

7308:

Wells, R. Spencer; Yuldasheva, Nadira; Ruzibakiev, Ruslan; Underhill, Peter A.; Evseeva, Irina; Blue-Smith, Jason; Jin, Li; Su, Bing; Pitchappan, Ramasamy; Shanmugalakshmi, Sadagopal; Balakrishnan, Karuppiah; Read, Mark; Pearson, Nathaniel M.; Zerjal, Tatiana; Webster, Matthew T.; Zholoshvili,

3862:

Balanovsky, Oleg; Gurianov, Vladimir; Zaporozhchenko, Valery; Balaganskaya, Olga; Urasin, Vadim; Zhabagin, Maxat; Grugni, Viola; Canada, Rebekah; Al-Zahery, Nadia; Raveane, Alessandro; Wen, Shao-Qing; Yan, Shi; Wang, Xianpin; Zalloua, Pierre; Marafi, Abdullah; Koshel, Sergey; Semino, Ornella;

1962:

belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006,

4644:

with a value of 8→9 within haplogroup Q-M242 and the trend is to include only binary markers in phylogenetic trees. However, these are from studies where all current branches of the Q-M242 tree have not been tested. The problematic phylogeny sampling of early studies has been demonstrated by

3972:

Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia,

1272:, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study (Dulik 2012), Q-M242 (mostly Q-M346 including some Q-M3) has been found in 24.3% (46/189: 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them, 10736:

Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation".

9852:

Rasmussen, Morten; Sikora, Martin; Albrechtsen, Anders; Korneliussen, Thorfinn Sand; Moreno-Mayar, J. Víctor; Poznik, G. David; Zollikofer, Christoph P. E.; Ponce De León, Marcia S.; Allentoft, Morten E.; Moltke, Ida; Jónsson, Hákon; Valdiosera, Cristina; Malhi, Ripan S.; Orlando, Ludovic;

9624:

3798:

K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik

10115:

Behar, Doron M.; Garrigan, Daniel; Kaplan, Matthew E.; Mobasher, Zahra; Rosengarten, Dror; Karafet, Tatiana M.; Quintana-Murci, Lluis; Ostrer, Harry; et al. (2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations".

3922:

Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008).

1443:(2018) found Q-L54(xM3) in 2.7% (2/75) and Q-M25 in another 2.7% (2/75) for a total of 5.3% (4/75) haplogroup Q Y-DNA in a sample of Khalkha Mongols from Ulaanbaatar, Mongolia. Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%. 6798:

The frequencies of Q-M242 shown in both studies (Kim2010, Park2012) are 1.4% (7/506, Kim) and 1.8% (13/706, Park) respectively. But, if recalculated by regional population weights, the adjusted frequencies reach 1.87% (Kim) and 1.91% (Park) respectively, converging to

6157:

E. J. VAJDA, "Siberian Link with Na-Dene Languages." The Dene–Yeniseian Connection, ed. by J. Kari and B. Potter(2010), pp.33–99, Anthropological Papers of the University of Alaska, new series, vol. 5(2010), Fairbanks: University of Alaska Fairbanks, Department of

854:

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Regardless, Q-M242 came to dominate the paternal lineages in the Americas.

2933:

of China, building three dynasties. His two queens were all princesses of the Yuan dynasty (Kublai Khan's granddaughters). It was very important for the Yuan dynasty to maintain a marriage alliance with Ongud tribe which had been a principal assistant since

10514:

Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia* genetic variation and the origins of Yakuts".

5484:

Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts".

7584:

Di Cristofaro, Julie; Pennarun, Erwan; Mazières, Stéphane; Myres, Natalie M.; Lin, Alice A.; Temori, Shah Aga; Metspalu, Mait; Metspalu, Ene; Witzel, Michael; King, Roy J.; Underhill, Peter A.; Villems, Richard; Chiaroni, Jacques (2013-10-18).

1724:

2013 found Q-M242 in 11/127 = 8.7% of a pool of samples of Uzbeks from three different provinces of Afghanistan, including 5/94 Q-M242(xM120, M25, M346, M378), 4/94 Q-M346, and 1/94 Q-M25 (10/94 = 10.6% Q-M242 total) in a sample of Uzbeks from

4277:

Kharkov, V. N.; Stepanov, V. A.; Medvedeva, O. F.; Spiridonova, M. G.; Voevoda, M. I.; Tadinova, V. N.; Puzyrev, V. P. (2007). "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups".

9205:

Grugni, Viola; Battaglia, Vincenza; Hooshiar Kashani, Baharak; Parolo, Silvia; Al-Zahery, Nadia; Achilli, Alessandro; Olivieri, Anna; Gandini, Francesca; Houshmand, Massoud; Sanati, Mohammad Hossein; Torroni, Antonio; Semino, Ornella (2012).

2859:. The Y-DNA of 12 men excavated from the site belonged to Q-MEH2 (Q1a) or Q-M378 (Q1b). The Q-M378 men among them were regarded as hosts of the tombs; half of the Q-MEH2 men appeared to be hosts and the other half as sacrificial victims. 1719:

2001 found P-M45(xM120, M124, M3, M173), which should be roughly equivalent to a mix of Q-M242(xM120, M3) and R2-M479(xR2a-M124), in 20/366 = 5.5% of a pool of samples of Uzbeks from seven different regions of Uzbekistan. Di Cristofaro

6553:

LIU, Shuhu; NIZAM, Yilihamu; RABIYAMU, Bake; ABDUKERAM, Bupatima; DOLKUN, Matyusup (February 2018). "应用Y染色体SNP对新疆三个隔离人群遗传多样性的研究 - 中国知网" [A study of genetic diversity of three isolated populations in Xinjiang using Y-SNP].

678:(YCC). Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages. 7309:

Irakli; Jamarjashvili, Elena; Gambarov, Spartak; Nikbin, Behrouz; Dostiev, Ashur; Aknazarov, Ogonazar; Zalloua, Pierre; Tsoy, Igor; Kitaev, Mikhail; Mirrakhimov, Mirsaid; Chariev, Ashir; Bodmer, Walter F. (28 August 2001).

355:

of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

10891:

Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas".

5639:

1978:), Q-M242 was found at its highest 12% (3/25) among Nana Chaudharis while the overall percentage in Gujarat was found to be 2.8% (8/284). In another study, 2.6% of Tharus in Chitwan district and 6.1% (3/49) of Hindus in 10265:

Cinnioglu, Cengiz; King, Roy; Kivisild, Toomas; Kalfoglu, Ersi; Atasoy, Sevil; Cavalleri, Gianpiero L.; Lillie, Anita S.; Roseman, Charles C.; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia".

783:

D pseudogene, is not represented in any current trees under Q-MEH2. The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an

9946:

Zhao, Yong-Bin; Zhang, Ye; Li, Hong-Jie; Cui, Ying-Qiu; Zhu, Hong; Zhou, Hui (November 2014). "Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixed into the Han Chinese 3,000 years ago".

4930:=> Guatemala population consists of about 40% Tribal Natives (Mayans)+60% Native (Spanish Speaking). According to this paper, 89% of Mayan and 25% of Ladinos belong to Y-DNA Q. Thus, 40*0.89+60*0.25=50.6% 2146:

males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region

7090:

Karafet, TM; et al. (Feb 2005). "Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders".

9909:

Hollard et al., Strong genetic admixture in the Altai at the Middle Bronze Age revealed by uniparental and ancestry informative makers, Forensic Science International: Genetics, published online 4 June

2246:, Faroe Islands, Iceland, and the United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia. Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of 8794:

Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.

10642:"Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists" 8174:"Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists" 6115:

Derenko, Miroslava; Malyarchuk, Boris; Denisova, Galina A.; et al. (2006). "Contrasting patterns of Y-chromosome variation in South Siberian populations from Baikal and Altai-Sayan regions".

2678:

in two separate groups. The Q-M378 subclade is a branch to which Q-M242 men in some European Jewish Diaspora populations belong. Its subbranch Q-L245's subclades Q-Y2200 and Q-YP1035 are found in

255:), approximately 17,000 to 31,700 years ago. However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the 6419: 1788:

in a study (Haber 2012). In another study (Cristofaro 2013) with a larger sampling, the frequency of Q rises to 8.9% (45/507). Haplogroup Q occurs at a frequency of 8% (11/136) in Afghan

2878:. These discoveries from the above papers (Li 2012, Kang et al., 2013) have some positive implications on the not as yet clearly verified theory that the Xiongnu were precursors of the 4256: 4184:

Bortolini, Maria-Catira; Salzano, Francisco M.; Thomas, Mark G.; Stuart, Steven; Nasanen, Selja P.K.; Bau, Claiton H.D.; Hutz, Mara H.; Layrisse, Zulay; et al. (September 2003).

8398:

Malyarchuk, B. A.; et al. (2008). "Gene Pool Structure of Russian Populations from the European Part of Russia Inferred from the Data on Y Chromosome Haplogroups Distribution".

6826:

Xue, Yali; Zerjal, Tatiana; Bao, Weidong; Zhu, Suling; Shu, Qunfang; Xu, Jiujin; Du, Ruofu; Fu, Songbin; Li, Pu; Hurles, Matthew E.; Yang, Huanming; Tyler-Smith, Chris (April 2006).

2874:, Xinjiang were found to be Q-M3 (Q1a2a1a1). And, as Q-M3 is mostly found in Yeniseians and Native Americans, the authors suggest that the Xiongnu had connections to speakers of the 267:

The polymorphism, “M242”, is a C→T transition residing in intron 1 (IVS-866) of the DBY gene and was discovered by Mark Seielstad et al. in 2003. The technical details of M242 are:

6538:

Lu Yan (2011), "Genetic Mixture of Populations in Western China." Shanghai: Fudan University, 2011: 1-84. (Doctoral dissertation in Chinese: 陆艳, “中国西部人群的遗传混合”, 上海：复旦大学，2011: 1-84.)

4792:

Hammer; et al. (Dec 2006). "Population structure of Y chromosome SNP haplogroups in the United States and forensic implications for constructing Y chromosome STR databases".

2779:

sites, westernmost Mongolian Altai, 2900YBP-4800YBP: 4 R1a1a1b2-Z93 (B.C. 10C, B.C. 14C, 2 period unknown), 3 Q1a2a1-L54 (period unknown), 1 Q-M242 (B.C. 28C), 1 C-M130 (B.C. 10C)

6176:

E. J. Vajda, Yeniseian Peoples and Languages: A History of Yeniseian Studies with an Annotated Bibliography and a Source Guide (2013, Oxford/New York, Routledge) pp.103-106, etc.

851:. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats. 447: 8172:

Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-, Cheryl-Emiliane T.; Chow, Emiliane T.; Lin, Alice A.; et al. (2006).

7422:

South Kazakhstan, Zhambyl, and Almaty Regions." Reports of the National Academy of Sciences of the Republic of Kazakhstan, ISSN 2224-5227, Volume 6, Number 316 (2017), 85 - 95.

820: 549: 483: 7058:

Yamamoto, Toshimichi; Senda, Tomoki; Horiba, Daiki; Sakuma, Masayoshi; Kawaguchi, Yuuka; Kano, Yuuichi (2013). "Y-chromosome lineage in five regional Mongolian populations".

8768:

David K. Faux, 2007, The Genetic Link of the Viking – Era Norse to Central Asia: An Assessment of the Y Chromosome DNA, Archaeological, Historical and Linguistic Evidence,

3634: 569: 511: 10846:

Wen, Bo; Li, Hui; Lu, Daru; Song, Xiufeng; Zhang, Feng; He, Yungang; Li, Feng; Gao, Yang; et al. (2004). "Genetic evidence supports demic diffusion of Han culture".

4134:

Karafet, T. M. (2002). "High Levels of Y-Chromosome Differentiation among Native Siberian Populations and the Genetic Signature of a Boreal Hunter-Gatherer Way of Life".

2308:

males belong to haplogroup Q-P36. This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3% (4/174)~5.6% (3/53) of

702: 612: 557: 519: 503: 491: 411: 9162:

Ghiani, ME; Moral, P; Mitchell, RJ; Hernández, M; García-Moro, C; Vona, G (2006). "Y-chromosome-Specific STR haplotype data on the Rapanui population (Easter Island)".

1753:(2018) found Q-M25 in 50.0% (22/44) of another sample of Turkmens from Turkmenistan, so the frequency of haplogroup Q in that country is not yet clear. However, Grugni 10552:

Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus; Pedersen, Jakob Skou; Albrechtsen, Anders; Moltke, Ida; Metspalu, Mait; Metspalu, Ene; et al. (February 2010).

4732:

Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus; Pedersen, Jakob Skou; Albrechtsen, Anders; Moltke, Ida; Metspalu, Mait; Metspalu, Ene; et al. (February 2010).

463: 3242: 589: 331:(YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in 10424:

Mirabal, Sheyla; Regueiro, Maria; Cadenas, Alicia M; Cavalli-Sforza, L Luca; Underhill, Peter A; Verbenko, Dmitry A; Limborska, Svetlana A; Herrera, Rene J (2009).

3232: 4655:

Malhi, RS; Gonzalez-Oliver, A; Schroeder, KB; Kemp, BM; Greenberg, JA; Dobrowski, SZ; Smith, DG; Resendez, A; Karafet, T; Hammer, M; Zegura, S; Brovko, T (2008).

3661:

Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome".

1963:

Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples. (For more information, see

3329: 3312: 806: 214: 10467:

Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms".

10007:

Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008

2107:) turned out to be P* (xR1-M173), which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Székelys (Szeklers) reaches 4.3%. 167: 3320: 802: 8685:

Csányi, B.; et al. (July 2008). "Y-Chromosome Analysis of Ancient Hungarian and Two Modern Hungarian-Speaking Populations from the Carpathian Basin".

1439:(1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25~1.25%), Q1a1b-M25 (0.25~0.63%), Q1b-M378. In another study, Q is found in 4% of Mongols. Karafet 4845:

Vullo, Carlos; et al. (2014). "Association between Y haplogroups and autosomal AIMs reveals intra-population substructure in Bolivian populations".

3479: 3472: 3465: 1109:

5.3% (13/246 in 8 provinces in northeastern, central, southern regions) to 23.4% (181/775 in 8 provinces in central-west, central, northwest regions) in

9265:

Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011).

5906: 9936:

On Henbei, Pengyang, and Heigouliang, Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)

4257:

https://www.researchgate.net/publication/310645015_Gene_pool_of_Turkmens_from_Karakalpakstan_in_their_Central_Asian_context_Y-chromosome_polymorphism

3588: 3583: 1323: 9002:

Behar, DM; et al. (Mar 2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations".

6756:

Jin Park, Myung; et al. (2012). "Understanding the Y chromosome variation in Korea-relevance of combined haplogroup and haplotype analyses".

207: 92: 10603:

Regueiro, M.; Cadenas, A.M.; Gayden, T.; Underhill, P.A.; Herrera, R.J. (2006). "Iran: Tricontinental Nexus for Y-Chromosome Driven Migration".

9734: 7709:

Regueiro, M.; Cadenas, A.M.; Gayden, T.; Underhill, P.A.; Herrera, R.J. (2006). "Iran: Tricontinental Nexus for Y-Chromosome Driven Migration".

3003: 2500:(M25, M143) — Found with high frequency of 30-45% in Turkmens and Turkmenistan Confused with R1b1 because of P25. Found with high frequency in 1964: 4247:. High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas, 2004. 1529:

in one study and in 1.23% (29/2354) of males in Tibet in another study, but this haplogroup was not observed in a sample of males from Tibet (

6005:"Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaian" 5178:

Rojas, Win; et al. (2010). "Genetic Make Up and Structure of Colombian Populations by Means of Uniparental and Biparental DNA Markers".

4533: 2848: 2005:. In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242. 5250:

Corach, Daniel; et al. (2010). "Inferring Continental Ancestry of Argentineans from Autosomal, Y-Chromosomal and Mitochondrial DNA".

9047:"The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula" 10974:"High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas" 4326:"Genetic relationships between Tuva population and the neighboring populations in the Altai Region of Xinjiang Uygur Autonomous Region" 4004:"High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas" 3008: 2162:, Q-M242 is found in about 2.6% (~4%) of males, with Q-L804 being more common than Q-F1161/L527. It is observed among 1.6% of males in 1684:

tribe (27/40 = 67.5%), and it was much less common among the other tribes. The Qangly tribe is related at least in name to the earlier

340: 9998:

L. L. Kang et al., Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families (2013)

2420:(at 10.3%), although the level of STR diversity associated with Q-MEH2 is very low, this lineage appears to be closest to the extinct 1711:

2001 found P-DYS257(xQ1b1a1a-M3, R-UTY2), which should be roughly equivalent to haplogroup Q-M242(xM3), in 4/54 = 7.4% of a sample of

6581:

Shan; et al. (Sep 2014). "Genetic polymorphism of 17 Y chromosomal STRs in Kazakh and Uighur populations from Xinjiang, China".

11078: 10303:

Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2006).

9419:

Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin; Huang, Xingqiu; Jin, Li; Li, Hui (2011).

8114:

Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007).

4450: 2898:, 700YBP: all 3 Q (not analysed subclade, the principal occupant Gaodangwang Korguz (高唐王=趙王阔里吉思)’s mtDNA=D4m2, two others mtDNA=A) 2847:

In a paper (Lihongjie 2012), the author analyzed the Y-DNAs of the ancient male samples from the 2nd or 1st century BCE cemetery at

2039:

Q-M242 is distributed across most European countries at low frequencies, and the frequencies decrease to the west and to the south.

11118: 10019:"Identification of kinship and occupant status in Mongolian noble burials of the Yuan dynasty through a multidisciplinary approach" 4641: 2844:, 2200YBP: 6 Q1a* (not Q1a1-M120, not Q1a1b-M25, not Q1a2-M3), 4 Q1b-M378, 2 Q* (not Q1a, not Q1b: unable to determine subclades): 10389:

Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005).

9306:

Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Khoyt, Sanj; Woźniak, Marcin; Grzybowski, Tomasz; Zakharov, Ilya (2013).

5531:

Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005).

1337:(north Siberia) at 66.4% (87/131). Russian ethnographers believe that their ancient places were farther south, in the area of the 6480:

Zhao, Yong-Bin; Zhang, Ye; Zhang, Quan-Chao; Li, Hong-Jie; Cui, Ying-Qiu; Xu, Zhi; Jin, Li; Zhou, Hui; Zhu, Hong (May 4, 2015).

779:

The subclade (under Q-MEH2) proposed by Sharma (2007), which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human

9595: 3639: 2930: 2913:

tribe. He died in 1298 and was reburied in Shuzhuanglou in 1311 by his son. (Do not confuse this man with the Uyghur governor,

2718: 1765:(2013) found Q-M25 in 31.1% (23/74) and Q-M346 in 2.7% (2/74) for a total of 33.8% (25/74) Q-M242 in a sample of Turkmens from 9421:"Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes" 1280:

at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120). In a former study, Q-M242 is found in 4.2% of southern

11054: 11018: 10783: 8091: 4474:

Seielstad, Mark; Yuldasheva, Nadira; Singh, Nadia; Underhill, Peter; Oefner, Peter; Shen, Peidong; Wells, R. Spencer (2003).

3925:"Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" 2142:, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of 872: 9671:"Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route" 6387:"Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route" 6346:"Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route" 2238:

of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of

1606:, the frequency is 7.1% in one study of a sample of Vietnamese reported to be from southern Vietnam and 4.3% in a sample of 7828:"In search of the genetic footprints of Sumerians: a survey of Y-chromosome and mtDNA variation in the Marsh Arabs of Iraq" 1637:

Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in

17: 5748:"High frequencies of Y-chromosome haplogroup O2b-SRY465 lineages in Korea: a genetic perspective on the peopling of Korea" 4829: 10793:

Wells, R. S.; Yuldasheva, N; Ruzibakiev, R; Underhill, PA; Evseeva, I; Blue-Smith, J; Jin, L; Su, B; et al. (2001).

9546:

Zalloua, Pierre A.; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ; et al. (2008).

8341:"Genetic Structure of Tibeto-Burman Populations of Bangladesh: Evaluating the Gene Flow along the Sides of Bay-of-Bengal" 6100:

KHARKOV, Vladimir Nikolaevich, "СТРУКТУРА И ФИЛОГЕОГРАФИЯ ГЕНОФОНДА КОРЕННОГО НАСЕЛЕНИЯ СИБИРИ ПО МАРКЕРАМ Y-ХРОМОСОМЫ,"

4550: 115: 10346:

Gayden, T; Cadenas, AM; Regueiro, M; Singh, NB; Zhivotovsky, LA; Underhill, PA; Cavalli-Sforza, LL; Herrera, RJ (2007).

210:(L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations. 5330:

Villalta, M.; Rodriguez, A.; González, L.; Arce, V.; Arrieta, G.; Morales, A.; Gusmão, L.; Espinoza, M. (August 2008).

2963: 2598: 1358: 1018: 816: 171: 8895:"Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome" 7934:

Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009).

5303:

Ramallo; et al. (Dec 2009). "Comparison of Y-chromosome haplogroup frequencies in eight Provinces of Argentina".

5016:

Gaviria, A.; et al. (2013). "Characterization and Haplotype analysis of 11 Y-STR loci in Ecuadorian population".

2871: 8037:

Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia".

3123: 2686:

carry other subclades of Q-L245, including Q-BZ3900, Q-YP745, and Q-YP1237. Q-M378 samples also have been located in

2155:), and rarely to the north. If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%. 199: 10070:

Abu-Amero, Khaled K; Hellani, Ali; González, Ana M; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009).

8727: 5365:"Disclosing the Genetic Structure of Brazil through Analysis of Male Lineages with Highly Discriminating Haplotypes" 2265:

also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland

11113: 9093:

Alain Farhi et al., Preliminary Results of Sephardic DNA Testing, AVOTAYNU Volume XXIII, Number 2 Summer 2007, p.10

8843: 5910: 592:. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages. 3780:

Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.

9989:

Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)

8857: 8492:"Y-chromosomal diversity of the Valachs from the Czech Republic: model for isolated population in Central Europe" 6435:"Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixed into the Han Chinese 3,000 years ago" 6400:(1). Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution: 717–727. 4704: 3113: 1299:

as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 14%~38.0% (41/108) of

46: 6881: 6482:"Ancient DNA Reveals That the Genetic Structure of the Northern Han Chinese Was Shaped Prior to 3,000 Years Ago" 6099: 1571:

and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in

11087: 5214:

Núñez, Carolina; et al. (2012). "Y chromosome haplogroup diversity in a Mestizo population of Nicaragua".

303: 256: 10929:

Zalloua, P; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, D; Royyuru, A; Herrera, R; et al. (2008).

10153:

Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z; et al. (2003).

9730: 7278:

Turspekov; et al. (2012). "The Kazakhstan DNA project hits first hundred Y-profiles for ethnic Kazakhs".

6882:"Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms" 6674:"Genetic Evidence of Paleolithic Colonization and Neolithic Expansion of Modern Humans on the Tibetan Plateau" 5577:

Wen B, Li H, Lu D, et al. (September 2004). "Genetic evidence supports demic diffusion of Han culture".

9267:"Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a" 8829: 8769: 6385:

Zhong, Hua; Shi, Hong; Qi, Xue-Bin; Duan, Zi-Yuan; Tan, Ping-Ping; Jin, Li; Su, Bing; Ma, Runlin Z. (2011).

6344:

Zhong, Hua; Shi, Hong; Qi, Xue-Bin; Duan, Zi-Yuan; Tan, Ping-Ping; Jin, Li; Su, Bing; Ma, Runlin Z. (2011).

6061:"Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a" 5620: 3826:

Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.)

10640:

Sengupta, S; Zhivotovsky, L; King, R; Mehdi, S; Edmonds, C; Chow, C; Lin, A; Mitra, M; et al. (2006).

10230:

Cadenas, Alicia M; Zhivotovsky, Lev A; Cavalli-Sforza, Luca L; Underhill, Peter A; Herrera, Rene J (2007).

10196:

Cadenas, Alicia M; Zhivotovsky, Lev A; Cavalli-Sforza, Luca L; Underhill, Peter A; Herrera, Rene J (2007).

9480:"The Y-Chromosome Tree Bursts into Leaf: 13,000 High-Confidence SNPs Covering the Majority of Known Clades" 9208:"Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians" 7649:"Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians" 6297:"An updated tree of Y-chromosome Haplogroup O and revised phylogenetic positions of mutations P164 and PK4" 3835:

Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)

4378:"Peopling of the North Circumpolar Region – Insights from Y Chromosome STR and SNP Typing of Greenlanders" 3091: 2654:(M378) — It is widely distributed in Europe, South Asia, West and East Asia. It is found among samples of 9853:

Bustamante, Carlos D.; Stafford, Thomas W.; Meltzer, David J.; Nielsen, Rasmus; Willerslev, Eske (2015).

8569:"Paleo-Balkan and Slavic Contributions to the Genetic Pool of Moldavians: Insights from the Y Chromosome" 6104:

03.02.07 and "АВТОРЕФЕРАТ диссертации на соискание учёной степени доктора биологических наук," Tomsk 2012

8433:

Khar'kov, VN; et al. (Aug 2005). "Frequencies of Y chromosome binary haplogroups in Belarussians".

4572:

Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008).

3865:"Phylogeography of human Y-chromosome haplogroup Q3-L275 from an academic/citizen science collaboration" 910:

rather than Native Americans. Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in

7759:"Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape" 1288: 4657:"Distribution of Y chromosomes among native North Americans: a study of Athapaskan population history" 1676:. A study published in 2017 found haplogroup Q Y-DNA in 3.17% (41/1294) of a large pool of samples of 1349:). Their populations are currently small in number, being just under 1,500 and 5,000 respectively. In 8750: 8738: 4574:"New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree" 2028: 1000: 758: 654: 541: 473: 307: 2539:(L56, L57, M346) — Found at low frequency in Europe, South Asia and West Asia. It has been found in 1989:

In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237:

9532:(2015), "A recent bottleneck of Y chromosome diversity coincides with a global change in culture." 3302: 2926: 1860: 902:. Surprisingly, he turned out to be genetically more closely related to Far East Siberians such as 8944:"Uniparental markers of contemporary Italian population reveals details on its pre-Roman heritage" 8282:"Mitochondrial and Y-chromosome diversity of the Tharus (Nepal): a reservoir of genetic variation" 4530: 11082: 9714: 8223:"Y Chromosome Haplogroup Distribution in Indo-European Speaking Tribes of Gujarat, Western India" 7375:"A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas" 6949:"Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences" 4476:"A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas" 3505: 2837:, 2500YBP: all 4 Q1a1-M120 (with a lot of animal bones and bronze swords and other weapons, etc.) 2329: 1614:

in southern Vietnam, but 0% or under 1% in other studies in which samples have been collected in

1350: 675: 328: 8992:

In Table S4, #BEL50 is estimated to be Q-M378 by haplotype, though it is shown as just P* (xR1).

6167:

E. G. Pulleyblank, "The consonontal system of old Chinese" , Asia Major, vol. IX (1962), pp. 1–2

5240:

The author revised his previous paper, genotyping 2 more samples as haplogroup Q by Y-SNP test.

3494: 3486: 3226: 2477: 2243: 1785: 302:

phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by

10683:

Sharma, Swarkar; Rai, Ekta; Bhat, Audesh K; Bhanwer, Amarjit S; Bamezai, Rameshwar NK (2007).

10305:"Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan" 8116:"Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan" 7477:"Paternal Population History of East Asia: Sources, Patterns, and Microevolutionary Processes" 4558: 3736:

F-Y27277, sometimes known as F2'4, is both the parent clade of F2 and F4 and a child of F-M89.

6713:

Kim, Soon-Hee; et al. (Nov 2010). "'Y chromosome homogeneity in the Korean population".

6433:

Zhao, Yong-Bin; Zhang, Ye; Li, Hong-Jie; Cui, Ying-Qiu; Zhu, Hong; Zhou, Hui (Nov–Dec 2014).

3556: 3402: 2182:

are labelled as R1b-Branch A, but they are actually Q-M242. On the other hand, it is 0.2% in

1400: 1157: 252: 237: 72: 9536:

25:1–8. Published by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/15; www.genome.org.

9105:"Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events" 8539: 7527:"Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events" 6567: 2210:, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as 10855: 10806: 10696: 10565: 9866: 9759: 9669:

Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010).

9432: 9373: 9219: 9116: 8955: 8815: 8639: 8580: 8553: 8352: 8293: 8234: 7839: 7770: 7660: 7598: 7538: 7322: 7160: 7012: 6493: 5957: 5586: 5413:=> about 80 out of 2,024 (3.95%) samples in the paper collected from all the regions of 5376: 5132: 4970: 4745: 4389: 3876: 3595: 3514: 3449: 3393: 3378: 3364: 3285: 3257: 2560: 2119: 1902: 683: 597: 241: 82: 31: 10391:"Dual origins of the Japanese* common ground for hunter-gatherer and farmer Y chromosomes" 8781: 8476: 6828:"Male Demography in East Asia: A North–South Contrast in Human Population Expansion Times" 6633:"Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes" 6386: 6256:"Siberian genetic diversity reveals complex origins of the Samoyedic-speaking populations" 5533:"Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes" 2347:

To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.

1879:

who built many Turkic empires and dynasties. Other studies also show similar frequencies.

1361: 8: 9103:

Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF, et al. (2012).

4638: 3106: 2902: 2875: 2298: 1553: 1416: 1354: 10859: 10810: 10700: 10569: 9870: 9763: 9436: 9377: 9223: 9120: 8959: 8643: 8584: 8356: 8297: 8238: 7843: 7774: 7664: 7602: 7542: 7432:

Malyarchuk, B; et al. (Jan 2013). "Y-chromosome variation in Tajiks and Iranians".

7326: 7164: 7016: 6497: 5961: 5590: 5380: 5136: 4974: 4749: 4393: 3880: 3152:

Please help update this article to reflect recent events or newly available information.

1548:

at 2.7% and decreasing ones to the south (Kim 2010). It has been found in about 0.3% of

10955: 10930: 10917: 10879: 10762: 10719: 10684: 10666: 10641: 10628: 10586: 10553: 10540: 10502: 10450: 10425: 10372: 10347: 10329: 10304: 10291: 10179: 10154: 10141: 10098: 10071: 10043: 10018: 9972: 9887: 9854: 9834: 9780: 9747: 9650: 9572: 9547: 9506: 9479: 9455: 9420: 9396: 9361: 9242: 9207: 9187: 9139: 9104: 9071: 9046: 9027: 8978: 8943: 8919: 8894: 8803: 8710: 8662: 8627: 8603: 8568: 8516: 8491: 8458: 8415: 8375: 8340: 8316: 8281: 8257: 8222: 8198: 8173: 8140: 8115: 8062: 8011: 7986: 7962: 7935: 7862: 7827: 7793: 7758: 7734: 7683: 7648: 7621: 7586: 7561: 7526: 7501: 7476: 7457: 7399: 7374: 7255: 7230: 7183: 7148: 7126: 7035: 7000: 6973: 6948: 6922: 6852: 6827: 6781: 6738: 6606: 6516: 6481: 6462: 6321: 6296: 6231: 6206: 6140: 6029: 6004: 5980: 5945: 5878: 5851: 5774: 5747: 5718: 5693: 5665: 5610: 5510: 5399: 5364: 5285: 5155: 5120: 4993: 4958: 4916: 4889: 4870: 4766: 4733: 4681: 4656: 4598: 4573: 4508: 4475: 4412: 4377: 4355: 4303: 4210: 4185: 4159: 4104: 4077: 3952: 3899: 3864: 3686: 3524: 3198: 3181: 3070: 3030: 2761: 1734: 1557: 1346: 1032:

The frequencies of Q among the whole male population of each country reach as follows:

848: 844: 785: 738: 641: 636: 385: 222: 10426:"Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia" 7888:

Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008).

6207:"Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia" 5456: 5431: 3924: 3703: 30:

This article is about the human Y-DNA haplogroup. For the human mtDNA haplogroup, see

11050: 11024: 11014: 10995: 10960: 10909: 10871: 10834: 10829: 10794: 10779: 10754: 10724: 10671: 10620: 10591: 10532: 10494: 10480: 10455: 10412: 10377: 10334: 10283: 10253: 10219: 10184: 10133: 10103: 10048: 9964: 9892: 9826: 9785: 9748:"The genome of a Late Pleistocene human from a Clovis burial site in western Montana" 9692: 9642: 9577: 9511: 9460: 9401: 9329: 9288: 9247: 9179: 9144: 9076: 9019: 8983: 8924: 8702: 8698: 8667: 8608: 8521: 8450: 8380: 8321: 8262: 8203: 8145: 8087: 8054: 8016: 7967: 7911: 7867: 7798: 7726: 7688: 7626: 7566: 7506: 7449: 7404: 7350: 7345: 7310: 7260: 7188: 7118: 7040: 6978: 6914: 6900: 6857: 6773: 6730: 6695: 6654: 6598: 6521: 6454: 6411: 6367: 6326: 6277: 6236: 6132: 6082: 6034: 5985: 5883: 5823: 5779: 5723: 5657: 5602: 5554: 5502: 5461: 5404: 5277: 5263: 5231: 5195: 5160: 5101: 5066: 4998: 4921: 4862: 4809: 4771: 4686: 4621: 4603: 4513: 4495: 4417: 4347: 4295: 4215: 4151: 4109: 4025: 3957: 3904: 3755: 3678: 3611: 3602: 3545: 3536: 3456: 3427: 3387: 3345: 3297: 3215: 3080: 3075: 3065: 3045: 3035: 2644: 2628: 2535: 2505: 2445: 2432: 2332:

people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from

1852: 1848: 1836: 1758: 1642: 1623: 1618:

in northern Vietnam. So, it is hard to define average frequencies. However, Macholdt

1607: 1545: 1404: 864: 836: 828: 812: 750: 730: 712: 648: 630: 618: 533: 423: 393: 324: 155: 10921: 10544: 10295: 10145: 9976: 9603: 9360:

Di Cristofaro, J; Pennarun, E; Mazières, S; Myres, NM; Lin, AA; et al. (2013).

9191: 9031: 8714: 8419: 8066: 6785: 6742: 6610: 6466: 6144: 5852:"Taiwan Y-chromosomal DNA variation and its relationship with Island Southeast Asia" 5669: 5514: 5097: 4890:"Genomic insights on the ethno-history of the Maya and the 'Ladinos' from Guatemala" 4805: 4627:

Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.

4359: 3690: 2938:'s period. About 16 princesses of the Yuan dynasty married kings of the Ongud tribe. 10985: 10950: 10942: 10901: 10883: 10863: 10824: 10814: 10766: 10746: 10714: 10704: 10661: 10653: 10632: 10612: 10581: 10573: 10524: 10506: 10484: 10476: 10445: 10437: 10402: 10367: 10359: 10324: 10316: 10275: 10243: 10209: 10174: 10166: 10155:"Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas" 10125: 10093: 10083: 10038: 10030: 9956: 9882: 9874: 9838: 9816: 9775: 9767: 9682: 9654: 9634: 9567: 9559: 9501: 9491: 9450: 9440: 9391: 9381: 9319: 9278: 9237: 9227: 9171: 9134: 9124: 9066: 9058: 9011: 8973: 8963: 8914: 8906: 8694: 8657: 8647: 8598: 8588: 8511: 8503: 8462: 8442: 8407: 8370: 8360: 8311: 8301: 8252: 8242: 8193: 8185: 8135: 8127: 8046: 8006: 7998: 7957: 7947: 7901: 7857: 7847: 7788: 7778: 7738: 7718: 7678: 7668: 7616: 7606: 7556: 7546: 7496: 7488: 7461: 7441: 7394: 7386: 7340: 7330: 7250: 7242: 7178: 7168: 7130: 7108: 7100: 7067: 7030: 7020: 7001:"Genetic Structure of Qiangic Populations Residing in the Western Sichuan Corridor" 6968: 6960: 6926: 6904: 6896: 6847: 6839: 6765: 6722: 6685: 6644: 6590: 6563: 6511: 6501: 6446: 6401: 6357: 6316: 6308: 6267: 6226: 6218: 6124: 6072: 6024: 6016: 5975: 5965: 5873: 5863: 5813: 5769: 5759: 5713: 5705: 5649: 5614: 5594: 5544: 5494: 5451: 5443: 5394: 5384: 5343: 5312: 5289: 5267: 5259: 5223: 5187: 5150: 5140: 5093: 5084:

Lovo-Gómez, J; et al. (Sep 2007). "The genetic male legacy from El Salvador".

5056: 5045:"Admixture and population structure in Mexican-Mestizos based on paternal lineages" 5025: 4988: 4978: 4911: 4901: 4874: 4854: 4801: 4761: 4753: 4676: 4668: 4593: 4585: 4503: 4487: 4407: 4397: 4337: 4287: 4205: 4197: 4186:"Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas" 4163: 4143: 4099: 4089: 4015: 3947: 3939: 3894: 3884: 3670: 3578: 3336: 3290: 3055: 3050: 3040: 2513: 2496: 2385: 2286: 1801: 1766: 1726: 1627: 1611: 1561: 1353:, the Ket language is significant as it is currently the only surviving one in the 832: 720: 624: 439: 431: 403: 7149:"Patrilineal Perspective on the Austronesian Diffusion in Mainland Southeast Asia" 4959:"The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q" 4437: 4307: 2130:

respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.

1649:(1/14) regions in southwest Myanmar. And, Q-M242 is found in 55.6% (15/27) in the 11044: 11008: 9445: 9386: 9232: 9129: 8968: 8652: 8593: 8365: 8247: 8081: 7783: 7673: 7611: 7551: 7445: 7173: 7071: 7025: 6506: 5970: 5802:"Major East–West Division Underlies Y Chromosome Stratification across Indonesia" 5389: 5348: 5331: 5316: 5227: 5145: 5029: 4983: 4833: 4554: 4537: 4402: 4342: 4325: 3350: 3060: 2978: 2830: 2769: 2687: 2667: 2589: 2576: 2449: 2262: 2139: 2009: 1952: 1917: 1901:

belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the

1864: 1549: 1507: 1463: 1408: 1372:, A. Vovin, etc.) Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346), 1365: 1342: 1338: 1319: 1265: 1169: 843:

lineages. In North America, two other Q-lineages also have been found. These are

840: 455: 248: 183: 163: 8816:"Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy" 8782:"Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy" 8751:"Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy" 8554:"Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy" 8540:"Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy" 8477:"Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy" 6843: 6812:(2000), "Y chromosome sequence variation and the history of human populations." 4826: 4059: 1525:

Haplogroup Q was observed in 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in

10946: 10072:"Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions" 9563: 9062: 8002: 7936:"Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions" 7315:

Proceedings of the National Academy of Sciences of the United States of America

6434: 6254:

Karafet, Tatiana M.; Osipova, Ludmila P.; Savina, Olga V.; et al. (2018).

6020: 3943: 3566: 3359: 3192: 3099: 2988: 2747: 2683: 2679: 2473: 2469: 2425: 2305: 2219: 2207: 2048: 1928: 1856: 1844: 1742: 1584: 1396: 1312: 1292: 1165: 907: 895: 127: 10931:"Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events" 10528: 10407: 10390: 10279: 10129: 9548:"Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events" 9015: 8446: 8411: 8050: 7987:"Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events" 6769: 6726: 6649: 6632: 6594: 6128: 5549: 5532: 5498: 4906: 4858: 4291: 3889: 2231: 1450:

belong to subclade Q-M120, which distributes most intensively across northern

11107: 10795:"The Eurasian Heartland: A continental perspective on Y-chromosome diversity" 8628:"Y-Chromosome Diversity in Modern Bulgarians: New Clues about Their Ancestry" 7852: 7311:"The Eurasian Heartland: A continental perspective on Y-chromosome diversity" 4499: 3811: 3759: 3441: 3435: 3421: 3410: 3373: 3276: 3271: 3262: 3248: 3209: 2973: 2958: 2922: 2757: 2728: 2695: 2633: 2608: 2604: 2441: 2397: 2389: 2309: 2290: 2167: 2064: 1990: 1975: 1959: 1932: 1913: 1872: 1808:

show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by

1693: 1677: 1646: 1519: 1491: 1459: 1381: 1377: 1373: 1334: 1153: 1026: 884: 824: 780: 311: 135: 11093: 10990: 10973: 10709: 10320: 10248: 10231: 10214: 10197: 10088: 9687: 9670: 9496: 8507: 8306: 8131: 7952: 7906: 7889: 7217: 6690: 6673: 6631:

Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; et al. (2006).

6406: 6362: 6345: 5868: 5818: 5801: 4094: 4020: 4003: 3861: 1927:

belong to haplogroup Q. In a study (Gokcumen 2008), it was found that among

1882:

In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in

1669:, the southern regions show higher frequencies of Q than the northern ones. 1599:. However, other studies show 0% or near 0% frequencies in those countries. 10999: 10964: 10913: 10875: 10838: 10819: 10758: 10728: 10675: 10624: 10595: 10536: 10498: 10459: 10416: 10381: 10338: 10287: 10257: 10223: 10188: 10137: 10107: 10052: 10034: 9968: 9896: 9830: 9789: 9696: 9646: 9581: 9515: 9464: 9405: 9333: 9292: 9251: 9183: 9148: 9080: 9023: 8987: 8928: 8706: 8671: 8612: 8525: 8454: 8384: 8325: 8266: 8207: 8149: 8058: 8020: 7971: 7915: 7871: 7802: 7730: 7692: 7630: 7570: 7510: 7453: 7408: 7354: 7335: 7264: 7192: 7122: 7044: 6999:

Wang C-C, Wang L-X; Shrestha, R; Zhang, M; Huang, X-Y; et al. (2014).

6982: 6947:

Poznik, G. David; Xue, Yali; Mendez, Fernando L.; et al. (June 2016).

6918: 6861: 6777: 6734: 6699: 6658: 6602: 6525: 6458: 6415: 6371: 6330: 6281: 6240: 6136: 6086: 6038: 5989: 5887: 5827: 5783: 5764: 5727: 5661: 5606: 5558: 5506: 5465: 5408: 5281: 5235: 5199: 5164: 5105: 5070: 5002: 4925: 4866: 4813: 4775: 4690: 4645:

subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.

4607: 4517: 4421: 4351: 4299: 4219: 4155: 4113: 4029: 3961: 3908: 3682: 3121: 2935: 2888: 2851:

in Xinjiang – which is also believed to be the site of a summer palace for

2811: 2807: 2612: 2556: 2485: 2421: 2321: 2247: 2096: 1994: 1898: 1868: 1820: 1805: 1746: 1730: 1689: 1666: 1412: 1388: 1369: 1304: 1281: 1245: 1241: 1177: 1161: 299: 218: 68: 10905: 9175: 8910: 7246: 7104: 5800:

Karafet, Tatiana M.; Hallmark, Brian; Cox, Murray P.; et al. (2010).

5653: 5432:"The Dual Origin and Siberian Affinities of Native American Y Chromosomes" 4147: 1955:, the frequency of haplogroup Q-M242 is about 2.2% (14/638)~3.4% (6/176). 10229: 10195: 9324: 9308:"Y-chromosome diversity in the Kalmyks at the ethnical and tribal levels" 9307: 8770:

http://www.davidkfaux.org/CentralAsiaRootsofScandinavia-Y-DNAEvidence.pdf

7887: 7212:, "The paternal and maternal genetic history of Vietnamese populations." 6312: 2993: 2906: 2732: 2548: 2517: 2437: 2373: 2337: 2223: 2114:

region shows a frequency at 1.2% in a study, but it may reach over 4% in

2056: 1936: 1887: 1876: 1774: 1741:(2001) found P-M45(xM120, M124, M3, M173) in 10.0% (3/30) of a sample of 1650: 1592: 1479: 1296: 1269: 1229: 1075: 1022: 819:. Most of them are descendants of the major founding groups who migrated 175: 11046:

Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements

10867: 10577: 10441: 9878: 9771: 9283: 9266: 8083:

Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements

7147:

He, J-D; Peng, M-S; Quang, HH; Dang, KP; Trieu, AV; et al. (2012).

6222: 6077: 6060: 5598: 5061: 5044: 4757: 3718:

Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4).

2148: 2092: 1672:

In the northern regions, Q-M242 is found in about 2%~6% (average 4%) of

1140:(Altai region), and is widely distributed across it. Q-M242 is found in 327:

available for haplogroup Q-M242. The scientifically accepted one is the

10750: 9960: 9638: 6450: 6272: 6255: 5272: 5191: 4672: 4589: 4078:"A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India" 3674: 2968: 2791: 2552: 2341: 2304:

On the other hand, according to a study (Behar 2004), 5.2% (23/441) of

2251: 2175: 2115: 2088: 2076: 2060: 2051:, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of 2002: 1704: 1499: 1455: 1392: 1330: 1249: 1149: 1117: 925:

Q-M242 is estimated to occupy 3.1% of the whole US population in 2010:

915: 233: 111: 10616: 9851: 7722: 7113: 4708: 3804: 3758:

was known as "Haplogroup K2". That name has since been re-assigned to

2274: 1875:(Persian people), and so on. Turkmens are known as the descendants of 10513: 10489: 9362:"Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge" 9204: 8739:

Q-L712 Subclades of haplogroup Q-M25: Q-L712, Q-L715, Q-L713, Q-YP789

7587:"Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge" 6909: 5946:"Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge" 5621:

Supplementary Table 2: NRY haplogroup distribution in Han populations

5483: 3815:, 2017, "Details of the Y-SNP markers included in the minimal Y tree" 3013: 2856: 2818:, 2800-3000YBP: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O* 2795: 2325: 2191: 2127: 2123: 2084: 2080: 2013: 1979: 1733:, and 1/28 Q-M242(xM120, M25, M346, M378) in a sample of Uzbeks from 1588: 1447: 1276:

show the highest frequency at 60.0% (15/25: all Q-M346), followed by

1209: 1110: 1096: 1044: 911: 899: 179: 10423: 9821: 9804: 6964: 10657: 10363: 10170: 9920: 9478:

Hallast, Pille; Batini, Chiara; Zadik, Daniel; et al. (2014).

8189: 7492: 7390: 5709: 5447: 4491: 4276: 4201: 3771:

Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.

2998: 2870:

In L. L. Kang et al. (2013), three samples from a Xiongnu) site in

2841: 2743: 2572: 2568: 2540: 2525: 2501: 2465: 2377: 2369: 2235: 2111: 2052: 1948: 1832: 1797: 1789: 1770: 1685: 1654: 1596: 1503: 1467: 1432: 1308: 1273: 1225: 1217: 1185: 1089: 352: 203: 151: 147: 139: 123: 11098: 11028: 10792: 10685:"A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India" 9359: 7583: 7307: 3660: 1757:(2012) found Q-M242 in 42.6% (29/68) of a sample of Turkmens from 1326:

sub-group of Tobol-Irtysh group has a frequency of Q-M242 at 38%.

310:(UEPs). Haplogroup Q-M242, according to the most recent available 10302: 9264: 9102: 8113: 7523: 4654: 4473: 2917:

who died in 1242.) The Ongud tribe (汪古部) was a descendant of the

2864: 2852: 2834: 2825:(cf) Pengbo (倗伯), Monarch of Peng Kingdom is estimated as Q-M120. 2751: 2735:(South Central Siberia of Russia), 17000YBP: Q1a1-F1215 (mtDNA R) 2671: 2663: 2659: 2655: 2521: 2481: 2461: 2457: 2453: 2417: 2393: 2333: 2294: 2266: 2239: 2211: 2195: 2183: 2179: 2171: 2163: 2152: 2072: 1998: 1971: 1958:

In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of

1840: 1769:, Afghanistan, so the frequency of Q-M242 may reach about 40% in 1673: 1638: 1603: 1537: 1475: 1436: 1420: 1277: 1261: 1213: 1193: 1181: 1145: 1068: 1057: 1037: 919: 903: 827:. These small groups of founders must have included men from the 332: 159: 10972:

Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003).

4002:

Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2004).

1587:. In a study, the frequencies of haplogroup Q is 5.4% (2/37) in 1518:

Q-M242 has been found with notable frequency in some samples of

10069: 7933: 5414: 4571: 4451:"Y DNA Haplogroup P Gets a Brand-New Root – Plus Some Branches" 4045: 2918: 2914: 2855:

kings – which is east of the Barkol basin and near the city of

2815: 2787: 2776: 2691: 2529: 2282: 2242:. And, surprisingly, Q-M242 in Shetland (also in some areas of 2215: 2187: 2159: 2143: 2100: 2068: 1924: 1883: 1809: 1793: 1712: 1700: 1681: 1680:; however, haplogroup Q was concentrated in the members of the 1626:

people from northern Vietnam (all but one of whom are from the

1483: 1300: 1173: 1141: 1124: 1082: 1064: 876: 868: 143: 10971: 10602: 9735:

Afantova had haplogroup Q1a1 and some type of R derived mtdna.

9305: 7708: 4001: 1329:

The highest frequencies of Q-M242 in Eurasia are witnessed in

863:

In the indigenous people of North America, Q-M242 is found in

10264: 6205:

Mirabal S, Regueiro M, Cadenas AM, et al. (March 2009).

5332:"Haplotype data for 12 Y-chromosome STR loci from Costa Rica" 5329: 2983: 2910: 2895: 2892: 2699: 2675: 2564: 2381: 2365: 2278: 2222:, etc., but some regions show a little higher. It is 2.1% in 2021: 2017: 1983: 1891: 1631: 1615: 1572: 1568: 1541: 1526: 1495: 1487: 1471: 1451: 1431:

In some studies, various subgroups of Q-M242 are observed in

1221: 1205: 1201: 1197: 1189: 1103: 888: 880: 867:

at an average rate of 68%. The highest frequency is 92.3% in

336: 131: 119: 27:

Human Y chromosome DNA grouping common among Native Americans

10639: 10551: 10152: 9161: 8830:"Family Tree DNA - My FamilyTree DNA Latvia Project Website" 8171: 5121:"Exploring the Y Chromosomal Ancestry of Modern Panamanians" 4731: 4433: 4431: 4183: 2436:(M120, M265/N14) — It has been found at low frequency among 1912:

Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36)

811:

Several branches of haplogroup Q-M242 have been predominant

10554:"Ancient human genome sequence of an extinct Palaeo-Eskimo" 10114: 9726: 7231:"Retrieving Y chromosomal haplogroup trees using GWAS data" 6295:

Yan, Shi; Chuan-; Wang, Chao; Li, Hui; et al. (2011).

4734:"Ancient human genome sequence of an extinct Palaeo-Eskimo" 2879: 2544: 2509: 2489: 2407: 2270: 2227: 2104: 1906: 1824: 1778: 1237: 1233: 1137: 1051: 10345: 8874:

Wiik, Kalevi (2008). "Where did European Men Come From?".

7060:

Forensic Science International: Genetics Supplement Series

6998: 5336:

Forensic Science International: Genetics Supplement Series

5305:

Forensic Science International: Genetics Supplement Series

4324:

Yong-Ke, Zhang; Zheng, Chen; An, FAN; et al. (2009).

4041: 4039: 3704:

International Society of Genetic Genealogy (ISOGG; 2015),

891:

populations. (Q-M3 occupies 46% among Q in North America)

60:

17,200 to 31,700 years ago (approximately 24,500 years BP)

9932: 9930: 7057: 6672:

Qi, Xuebin; Cui, Chaoying; Peng, Yi; et al. (2013).

6552: 6114: 4428: 4076:

Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007).

3921: 3745:

Haplogroup LT (L298/P326) is also known as Haplogroup K1.

1729:, whose northern border abuts the southeastern corner of 1017:

Haplogroup Q-M242 has been found in approximately 94% of

1005:‡ Mainland and Alaska, not including the Pacific islands 583: 10928: 9803:

Raff, Jennifer A.; Bolnick, Deborah A. (February 2014).

9746:

Rasmussen, M.; Anzick, S.; et al. (February 2014).

9545: 7985:

Zalloua PA, Xue Y, Khalife J, et al. (April 2008).

3973:

supporting a northeastern Asian origin of these lineages

2174:). In an article (Helgason et al.) on the haplotypes of 1886:(x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in 1454:(the provinces of which the capitals locate northern to 10466: 10232:"Y-chromosome diversity characterizes the Gulf of Oman" 10198:"Y-chromosome diversity characterizes the Gulf of Oman" 7890:"Y-chromosome diversity characterizes the Gulf of Oman" 6879: 4467: 4036: 3863:

Tyler-Smith, Chris; Balanovska, Elena (February 2017).

1897:

Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in

807:

Y-DNA haplogroups in indigenous peoples of the Americas

10388: 9927: 6204: 5530: 1939:) haplogroup Q-M242 is seen with a prevalence of 13%. 262: 10348:"The Himalayas as a Directional Barrier to Gene Flow" 8036: 5694:"The Himalayas as a Directional Barrier to Gene Flow" 2712: 2603:

Q-M19 (M19) — Found among some indigenous peoples of

2376:, paragroup Q-M242 (xMEH2, xM378) was found in eight 1923:

Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in

1699:

In the southern regions, Q-M242 is found in 5%~6% of

1641:, and all the Q samples are concentrated in 18.8% in 803:

Genetic history of indigenous peoples of the Americas

10735: 10682: 9623: 9355: 9353: 9351: 9349: 9347: 9345: 9343: 7208:

Enrico Macholdt, Leonardo Arias, Nguyen Thuy Duong,

6253: 4075: 1634:) and found that two of them (4%) belong to Q-M120. 1387:

In far eastern Siberia, Q-M242 is found in 35.3% of

898:

individual belonging to Q1a-MEH2* has been found in

875:, 87% in SC Apache, and about 80% in North American 10890: 5638: 2087:, and 0.5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of 669: 9477: 8732: 8073: 5799: 4375: 2428:arisen in the New World Arctic about 5.5 Ka. 1012: 9340: 8032: 8030: 7984: 6630: 6054: 6052: 6050: 6048: 5939: 5937: 5935: 5933: 5931: 5929: 5927: 5634: 5632: 5630: 5628: 4705:"Frequency Distribution of Y-DNA Haplogroup Q M3" 2476:in Laos. It also has been reported in samples of 1435:. Q1a2-M346 (mostly Q-L330) occupies 1.4~3.1% of 11105: 9855:"The ancestry and affiliations of Kennewick Man" 9659:Q-M323 in 3/20=15% of a sample of Yemenite Jews. 9299: 8167: 8165: 8163: 8161: 8159: 7368: 7366: 7364: 6880:Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). 6808:Peter A. Underhill, Peidong Shen, Alice A. Lin, 6479: 6186:"Did the Xiong-nu speak a Yeniseian language?". 5479: 5477: 4952: 4950: 4948: 4946: 4944: 4942: 4940: 4938: 4936: 1827:, and gradually lowering ones to the southwest. 1781:who live in the areas adjacent to Turkmenistan. 1419:. It is also found in 15% (Q1a* 9%, Q-M3 6%) of 10799:Proceedings of the National Academy of Sciences 9745: 9539: 8619: 8391: 7929: 7927: 7925: 7704: 7702: 7204: 7202: 7146: 6946: 6825: 6294: 5042: 4727: 4725: 4542: 4438:Пять генофондов пяти субэтносов сибирских татар 4371: 4369: 4179: 4177: 4175: 4173: 9945: 9668: 8893:Di Gaetano, Cornelia; et al. (Jan 2009). 8273: 8027: 7883: 7881: 7425: 7415: 7085: 7083: 7081: 6432: 6384: 6343: 6045: 5924: 5845: 5843: 5841: 5839: 5837: 5795: 5793: 5625: 4376:Katharina Olofsson, Jill; et al. (2015). 4323: 4272: 4270: 4268: 4266: 4264: 3817:(Access date of these pages: 9 December 2017) 3004:Y-DNA haplogroups in populations of South Asia 2042: 1965:Y-DNA haplogroups in populations of South Asia 1357:which has been linked by some scholars to the 8156: 7752: 7750: 7748: 7642: 7640: 7361: 6942: 6940: 6938: 6936: 6875: 6873: 6871: 6802: 6626: 6624: 6622: 6620: 5687: 5685: 5683: 5681: 5679: 5526: 5524: 5474: 4933: 4129: 4127: 4125: 4123: 3107: 259:M242, P36.2, and MEH2 as defining mutations. 247:Q-M242 is believed to have arisen around the 9471: 8886: 8869: 8867: 8764: 8762: 8760: 8432: 8426: 8107: 7922: 7699: 7303: 7301: 7299: 7297: 7295: 7293: 7199: 5572: 5570: 5568: 4722: 4366: 4319: 4317: 4170: 4071: 4069: 4067: 3997: 3995: 3993: 3991: 3989: 3987: 3985: 3983: 3981: 3654: 2620:Q-M199 (M199, P106, P292) — In South America 1890:who are known as the descendants of ancient 588:Below is a 2012 tree by Thomas Krahn of the 51:Frequency distribution of haplogroup Q-M242. 10845: 9802: 9522: 9418: 8941: 8858:"Family Tree DNA - Switzerland DNA Project" 8678: 7978: 7878: 7468: 7078: 6994: 6992: 6247: 6198: 6108: 6093: 5834: 5790: 5425: 5423: 4565: 4261: 4060:Y-DNA Haplogroup Q and its Subclades - 2016 3855: 3789:Haplogroup P (P295) is also klnown as K2b2. 2754:, 12600YBP: Q1a2-L54* (not M3, mtDNA D4h3a) 1823:exhibits high frequencies of Q in northern 1812:at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346). 9662: 9528:Monika Karmin, Lauri Saag, Mário Vicente, 9096: 8995: 8892: 8625: 8483: 8397: 8338: 7819: 7745: 7637: 7431: 6933: 6868: 6617: 6548: 6546: 6544: 6058: 5943: 5741: 5739: 5737: 5676: 5521: 5083: 4120: 4055: 4053: 3697: 3114: 3100: 3009:Genetics and archaeogenetics of South Asia 1715:, apparently sampled in Uzbekistan. Wells 1333:(central Siberia) at 93.8% (45/48) and in 999:† According to the US National Population 341:International Society of Genetic Genealogy 45: 10989: 10954: 10828: 10818: 10718: 10708: 10665: 10585: 10488: 10449: 10406: 10371: 10328: 10247: 10213: 10178: 10097: 10087: 10042: 9886: 9820: 9779: 9686: 9617: 9588: 9571: 9505: 9495: 9454: 9444: 9395: 9385: 9323: 9282: 9241: 9231: 9138: 9128: 9070: 9045:Adams, Susan M.; et al. (Dec 2008). 8977: 8967: 8918: 8864: 8757: 8661: 8651: 8602: 8592: 8515: 8374: 8364: 8315: 8305: 8279: 8256: 8246: 8197: 8139: 8010: 7961: 7951: 7905: 7861: 7851: 7825: 7792: 7782: 7682: 7672: 7620: 7610: 7560: 7550: 7500: 7398: 7373:Seielstad, Mark; et al. (Sep 2003). 7372: 7344: 7334: 7290: 7277: 7254: 7229:Peng, Min-Sheng; et al. (Aug 2014). 7218:https://doi.org/10.1038/s41431-019-0557-4 7182: 7172: 7142: 7140: 7112: 7034: 7024: 6972: 6908: 6851: 6689: 6671: 6648: 6515: 6505: 6405: 6361: 6337: 6320: 6271: 6230: 6076: 6028: 5996: 5979: 5969: 5877: 5867: 5817: 5773: 5763: 5717: 5565: 5548: 5455: 5398: 5388: 5347: 5271: 5180:American Journal of Physical Anthropology 5154: 5144: 5060: 4992: 4982: 4956: 4915: 4905: 4765: 4680: 4648: 4597: 4507: 4411: 4401: 4341: 4314: 4209: 4103: 4093: 4064: 4019: 3978: 3951: 3898: 3888: 3730: 3020: 2520:), and with low to moderate frequency in 323:There are several confirmed and proposed 11042: 9602:. Genebase Systems. 2008. Archived from 9412: 8804:Shetland Islands Haplogroups R1a & Q 8567:Varzari, Alexander; et al. (2013). 8079: 7280:The Russian Journal of Genetic Genealogy 7222: 6989: 6755: 6574: 5692:Gayden, Tenzin; et al. (May 2007). 5420: 5043:Martínez-Cortés, G; et al. (2012). 4787: 4785: 4697: 3792: 3727:Haplogroup A1 is also known as A1'2'3'4. 2350: 1067:(30.8% (203/659) among the specifically 774: 9600:Wendy Tymchuk - Senior Technical Editor 8566: 8490:Ehler, Edvard; et al. (Jun 2011). 8339:Nahar Gazi, Nurun; et al. (2013). 8280:Fornarino, Simona; et al. (2009). 8220: 7474: 7089: 6819: 6758:International Journal of Legal Medicine 6706: 6541: 6288: 6059:Malyarchuk, Boris; et al. (2011). 5849: 5734: 5576: 5429: 5302: 5015: 4887: 4133: 4050: 3915: 2806:Hengbei site (Peng kingdom cemetery of 2099:(who have claimed to be descendants of 1692:. Haplogroup Q is found in about 2% of 1291:, which is located on the east side of 1252:, and so on. (For details, see below.) 343:(ISOGG) also provides an amateur tree. 215:Y-DNA haplogroup among Native Americans 14: 11106: 10935:The American Journal of Human Genetics 10646:The American Journal of Human Genetics 10352:The American Journal of Human Genetics 10159:The American Journal of Human Genetics 9805:"Genetic roots of the first Americans" 9051:The American Journal of Human Genetics 8684: 8626:Karachanak, Sena; et al. (2013). 8178:The American Journal of Human Genetics 7826:Al-Zahery, Nadia; et al. (2011). 7756: 7646: 7481:The American Journal of Human Genetics 7379:The American Journal of Human Genetics 7137: 6665: 6532: 6009:The American Journal of Human Genetics 5901: 5899: 5897: 5698:The American Journal of Human Genetics 5691: 5436:The American Journal of Human Genetics 5249: 5118: 4791: 4637:That is because it is a value for the 4480:The American Journal of Human Genetics 4190:The American Journal of Human Genetics 3087: 2931:Five Dynasties and Ten Kingdoms period 2719:List of haplogroups of historic people 2234:) region of France. It is about 4% in 1583:Haplogroup Q shows low frequencies in 674:This is the 2008 tree produced by the 584:The Genomic Research Center draft tree 545:M378/Page100, L214, L215/Page82 (Q2a) 346: 11010:The Journey of Man: A Genetic Odyssey 11006: 10776:The Journey of Man* A Genetic Odyssey 10773: 9044: 9001: 8489: 7757:Bekada, Asmahan; et al. (2013). 6568:10.16359/j.cnki.cn11-1963/q.2017.0067 6002: 5430:Jeffrey, T.; et al. (Jan 2002). 5362: 5213: 5177: 4844: 4782: 4448: 3774: 3712: 3095: 2867:site in Barkol, Xinjiang, all 3 Q-M3 2324:. It is observed in 0.7% (1/147), of 1916:and 2.0% (18/914, 14 Q*, 4 Q-M25) in 1622:(2020) have tested a sample of fifty 318: 236:Q-M242 is one of the two branches of 8873: 7228: 6580: 4551:"FTDNA Draft Y-DNA Tree (AKA YTree)" 3765: 3640:Y-DNA haplogroups of historic people 3615: 3610: 3601: 3599: 3594: 3592: 3587: 3582: 3577: 3571: 3564: 3554: 3552: 3542: 3534: 3522: 3520: 3511: 3503: 3461: 3454: 3448: 3446: 3440: 3434: 3432: 3426: 3420: 3408: 3398: 3392: 3386: 3377: 3372: 3363: 3358: 3349: 3344: 3308: 3294: 3177: 3132: 2406:(P36.2) Found with low frequency in 2320:Haplogroup Q is rarely found across 1081:15.3% (37/242) to 21.8% (89/408) in 10016: 7647:Grugni, Viola; et al. (2012). 6712: 5894: 5746:Kim, Soon-Hee; et al. (2011). 5745: 4888:Söchtig, Jens; et al. (2015). 3748: 3739: 3721: 3282: 3222: 3205: 2775:Tsagaan Asga and Takhilgat Uzuur-5 2724:South Central Siberia (near Altai) 2289:region, followed by 7.1% (2/28) in 2285:, where it reaches 16.7% (3/18) in 1567:Subclade Q1b-M378 is also found in 1540:, showing the highest frequency in 1536:It is found in about 1.9% of South 1311:near the international border with 894:On the other hand, a 4000-year-old 487:CTS1780, M981, M971, Z780 (Q1a2a1b) 263:Technical specification of mutation 116:Indigenous peoples of South America 24: 11094:The India Genealogical DNA Project 10430:European Journal of Human Genetics 10309:European Journal of Human Genetics 10236:European Journal of Human Genetics 10202:European Journal of Human Genetics 9552:American Journal of Human Genetics 8844:"Family Tree DNA - LITHUANIAN DNA" 8120:European Journal of Human Genetics 7214:European Journal of Human Genetics 6301:European Journal of Human Genetics 5907:"The Y Chromosome Consortium 2008" 3932:American Journal of Human Genetics 3829: 3820: 3783: 2964:Indigenous peoples of the Americas 2891:, Shuzhuanglou Site, northernmost 2798:, 4000YBP: Q1a-YP1500 (mtDNA D2a1) 2713:Y-DNA Q samples from ancient sites 2599:indigenous peoples of the Americas 2281:, but it rises to 2.5% (6/236) in 2269:, but it reaches 14.3% (13/91) in 2257: 2133: 2118:, in that 4.9% of the neighboring 1986:were found to be Q-M242 positive. 1796:. In this study(Cristofaro 2013), 1462:line). Q-M242 ranged from 4~8% in 1446:However, most of Q-M242 people in 817:indigenous peoples of the Americas 172:indigenous peoples of the Americas 25: 11130: 11072: 9949:American Journal of Human Biology 7475:Karafet; et al. (Sep 2001). 6260:American Journal of Human Biology 4548: 3709:. (Access date: 1 February 2015.) 2921:tribe (沙陀族) which was a tribe of 2632:(M323) — It has been detected in 2201: 1815: 1578: 1368:. (See: L. Lieti, E. Pulleybank, 1285:Q-M242 in Altaians is about 21%. 10481:10.1111/j.1469-1809.2006.00343.x 10010: 10001: 9992: 9983: 9939: 9913: 9903: 9845: 9796: 9739: 9720: 9703: 9596:"Learn about Y-DNA Haplogroup Q" 9258: 9198: 9155: 9087: 9038: 8935: 8850: 8836: 8822: 8808: 8797: 8788: 8774: 8743: 8721: 8699:10.1111/j.1469-1809.2008.00440.x 8560: 8546: 8532: 8469: 8332: 8221:Khurana, P; et al. (2014). 8214: 6901:10.1111/j.1469-1809.2006.00343.x 6422:from the original on 2020-05-07. 5944:Cristofaro; et al. (2013). 5264:10.1111/j.1469-1809.2009.00556.x 4707:. GeneTree. 2010. Archived from 4455:DNAeXplained - Genetic Genealogy 3137: 2909:(元世祖), and was the king of the 2617:Q-M194 (M194) — In South America 2001:6/88) in three ethnic groups of 1630:region, and 42 of whom are from 1415:, which is located northwest of 858: 670:The Y Chromosome Consortium tree 176:Akha people of northern Thailand 11119:Natural history of the Americas 10978:Molecular Biology and Evolution 10062: 9731:Y-SNP calls for Afontova Gora 2 9675:Molecular Biology and Evolution 9484:Molecular Biology and Evolution 7809: 7577: 7517: 7271: 7051: 6792: 6749: 6473: 6426: 6378: 6179: 6170: 6161: 6151: 5363:Palha, T.; et al. (2012). 5356: 5323: 5296: 5243: 5207: 5171: 5112: 5098:10.1016/j.forsciint.2006.07.005 5077: 5036: 5018:Forensic Sci. Int. Genet. Suppl 5009: 4957:Battaglia; et al. (2013). 4881: 4838: 4820: 4806:10.1016/j.forsciint.2005.11.013 4631: 4614: 4524: 4442: 4250: 4008:Molecular Biology and Evolution 3762:, the sibling of Haplogroup LT. 2887:Mongolian noble burials in the 1660: 1364:and, more controversially, the 1013:Mesoamerica & South America 934:Percentage of USA population † 791: 304:single-nucleotide polymorphisms 11049:. University of Pennsylvania. 8086:. University of Pennsylvania. 4226: 2951: 2764:, 8500YBP: Q1a2-M3 (mtDNA X2a) 2364:— Found with low frequency in 992:Q-P36* 31.2% & Q-M3 26.9% 914:, showing the highest in east 13: 1: 5417:can be classified as Y-DNA Q. 4449:Estes, Roberta (2020-09-12). 3849: 2424:individuals belonging to the 2122:harbor Q-M242. It is 1.3% in 1942: 1411:who live in the basin of the 1255: 786:autochthonous differentiation 369:P36.2, L232, L273, L274 (Q1) 10017:Qui, Y; et al. (2015). 9446:10.1371/journal.pone.0024282 9387:10.1371/journal.pone.0076748 9233:10.1371/journal.pone.0041252 9130:10.1371/journal.pone.0034288 8969:10.1371/journal.pone.0050794 8876:Journal of Genetic Genealogy 8653:10.1371/journal.pone.0056779 8594:10.1371/journal.pone.0053731 8366:10.1371/journal.pone.0075064 8248:10.1371/journal.pone.0090414 7816:with a large-scale sampling. 7784:10.1371/journal.pone.0056775 7674:10.1371/journal.pone.0041252 7612:10.1371/journal.pone.0076748 7552:10.1371/journal.pone.0034288 7446:10.3109/03014460.2012.747628 7174:10.1371/journal.pone.0036437 7072:10.1016/j.fsigss.2013.10.133 7026:10.1371/journal.pone.0103772 6507:10.1371/journal.pone.0125676 5971:10.1371/journal.pone.0076748 5390:10.1371/journal.pone.0040007 5349:10.1016/j.fsigss.2007.10.101 5317:10.1016/j.fsigss.2009.08.047 5228:10.1016/j.fsigen.2012.06.011 5146:10.1371/journal.pone.0144223 5030:10.1016/j.fsigss.2013.10.158 4984:10.1371/journal.pone.0071390 4403:10.1371/journal.pone.0116573 4343:10.3724/SP.J.1005.2009.00818 3124:Y-chromosome DNA haplogroups 2336:which is located in between 2277:. Also, it is about 0.6% in 2273:Islands and 6.1% (8/132) in 2178:, 7.2% (13/181) of males in 1784:Q-M242 accounts for 6.9% of 1426: 959:Q-P36* 3.8% & Q-M3 7.9% 948:Q-P36* 0.6% & Q-M3 0.1% 633:, L56, L57, L474, L892, L942 609:P36.2, L232, L273.1, L274.1 427:L56, L57, M346, L528 (Q1a2) 293: 277:Total size (base pairs): 366 7: 9727:YFull - Experimental Y Tree 8400:Russian Journal of Genetics 6844:10.1534/genetics.105.054270 6816:, Volume 26, November 2000. 3174: 3122:Phylogenetic tree of human 2946: 2929:) and was prominent in the 2905:was a son of a princess of 2151:,: not to be confused with 2091:On the other hand, 3.1% of 2079:,{citation needed} 1.2% of 2043:Central- and Eastern Europe 1407:). It is found in 30.8% of 821:from Asia into the Americas 796: 200:Y-chromosome DNA haplogroup 10: 11135: 10947:10.1016/j.ajhg.2008.01.020 9709:Brook, Kevin Alan (2018). 9564:10.1016/j.ajhg.2008.01.020 9063:10.1016/j.ajhg.2008.11.007 8003:10.1016/j.ajhg.2008.01.020 6556:Acta Anthropologica Sinica 6021:10.1016/j.ajhg.2011.12.014 3944:10.1016/j.ajhg.2007.11.013 3706:Y-DNA Haplogroup Tree 2015 3608: 3575: 3532: 3501: 3492: 3484: 3477: 3470: 3463: 3418: 3384: 3370: 3356: 3342: 3326: 3310: 3179: 2716: 2662:. It is also found in the 1951:at the eastern end of the 1761:, Iran, and Di Cristofaro 1552:(with known examples from 1380:(3.4%, Q-M25, Q-M346) and 1050:40.1% (159/397) to 50% in 800: 308:unique-event polymorphisms 228: 213:Q-M242 is the predominant 29: 11099:British Isles DNA Project 10529:10.1007/s00439-006-0213-2 10408:10.1007/s10038-005-0322-0 10395:Journal of Human Genetics 10280:10.1007/s00439-003-1031-4 10130:10.1007/s00439-003-1073-7 9312:Journal of Human Genetics 9271:Journal of Human Genetics 9016:10.1007/s00439-003-1073-7 8447:10.1007/s11177-005-0182-x 8412:10.1134/S1022795408020105 8051:10.1007/s00439-003-1031-4 6770:10.1007/s00414-012-0703-9 6727:10.1007/s00414-010-0501-1 6650:10.1007/s10038-005-0322-0 6637:Journal of Human Genetics 6595:10.1007/s00414-013-0948-y 6129:10.1007/s00439-005-0076-y 6065:Journal of Human Genetics 5550:10.1007/s10038-005-0322-0 5537:Journal of Human Genetics 5499:10.1007/s00439-006-0213-2 4907:10.1186/s12864-015-1339-1 4859:10.1007/s00414-014-1025-x 4292:10.1134/S1022795407050110 3890:10.1186/s12862-016-0870-2 3629: 3407: 3400: 3334: 3317: 3301: 3296: 3289: 3284: 3275: 3270: 3268: 3261: 3256: 3254: 3247: 3240: 3238: 3231: 3224: 3214: 3207: 3197: 3190: 3188: 3172: 3146:This article needs to be 3130: 2315: 2226:, and it reaches 5.1% in 2034: 1792:and 3% (5/142) in Afghan 1355:Yeniseian language family 996: 918:at 82% and the lowest in 451:CTS11969, M930 (Q1a2a1a) 274:Position (base pair): 180 271:Nucleotide change: C to T 107: 99: 88: 78: 64: 56: 44: 39: 10689:BMC Evolutionary Biology 10469:Annals of Human Genetics 9715:Rowman & Littlefield 8687:Annals of Human Genetics 7853:10.1186/1471-2148-11-288 7832:BMC Evolutionary Biology 7525:Pierre A. (2012-03-28). 6889:Annals of Human Genetics 5252:Annals of Human Genetics 5216:Forensic Sci. Int. Genet 3869:BMC Evolutionary Biology 2927:Western Turkic Khaganate 2170:(known to be related to 2020:and 3.2% of people from 1905:and 0.8% (1/121: Q*) in 1851:(Persian people), 6% in 1804:which is neighboring to 1533:=105) in a third study. 65:Possible place of origin 11114:Human Y-DNA haplogroups 11083:The Genographic Project 11043:Gokcumen, Omer (2008). 11007:Wells, Spencer (2002). 10774:Wells, Spencer (2002). 10710:10.1186/1471-2148-7-232 10321:10.1038/sj.ejhg.5201726 10249:10.1038/sj.ejhg.5201934 10215:10.1038/sj.ejhg.5201934 10089:10.1186/1471-2156-10-59 8942:Brisighelli, F (2012). 8508:10.3325/cmj.2011.52.358 8307:10.1186/1471-2148-9-154 8132:10.1038/sj.ejhg.5201726 8080:Gokcumen, Omer (2008). 7953:10.1186/1471-2156-10-59 7907:10.1038/sj.ejhg.5201934 6188:Central Asiatic Journal 6003:Dulik, M C (Feb 2012). 5869:10.1186/1471-2156-15-77 4095:10.1186/1471-2148-7-232 3754:Between 2002 and 2008, 2328:and in 0.6% (1/156) of 1970:In a regional study in 1391:(Gilyaks) in the lower 1351:linguistic anthropology 1131: 937:Haplogroup Q frequency 871:, followed by 78.1% in 676:Y Chromosome Consortium 590:Genomic Research Center 553:FGC1774, Y2016 (Q1b1a) 397:M120, M265/N14 (Q1a1a1) 329:Y Chromosome Consortium 217:and several peoples of 57:Possible time of origin 11079:Spread of Haplogroup Q 10820:10.1073/pnas.171305098 10035:10.1098/rstb.2013.0378 7336:10.1073/pnas.171305098 5850:Trejaut, J.A. (2014). 5765:10.1186/2041-2223-2-10 5752:Investigative Genetics 4661:Am. J. Phys. Anthropol 3021:Y-DNA Q-M242 subclades 2585:(L53, L54, L55, L213) 1839:, followed by 9.1% in 1688:and probably also the 1560:) and in 0.3%~1.2% of 1264:, the regions between 573:Y1150 (Q1b2) (Q1b-L68) 10991:10.1093/molbev/msh009 10906:10.1007/s004390000406 9688:10.1093/molbev/msq247 9497:10.1093/molbev/msu327 9176:10.1353/hub.2007.0005 8911:10.1038/ejhg.2008.120 7247:10.1038/ejhg.2013.272 7105:10.1353/hub.2005.0030 6691:10.1093/molbev/mst093 6407:10.1093/molbev/msq247 6363:10.1093/molbev/msq247 5819:10.1093/molbev/msq063 5654:10.1007/s004390000406 4148:10.1353/hub.2003.0006 4021:10.1093/molbev/msh009 2392:). Also found in one 2351:Subclade distribution 2312:are in haplogroup Q. 1591:, 3.1% (2/64) in the 1401:Siberian Yupik people 1158:Siberian Yupik people 1136:Q-M242 originated in 801:Further information: 775:Phylogenetic variants 288:tccaatctcaattcatgcctc 282:aactcttgataaaccgtgctg 253:South Central Siberia 202:. It has one primary 73:South Central Siberia 11013:. Random House LLC. 9711:The Jews of Khazaria 9325:10.1038/jhg.2013.108 6313:10.1038/ejhg.2011.64 4827:Population Estimates 4330:Yi Chuan = Hereditas 2561:United Arab Emirates 2416:(MEH2) Was found in 2120:Iranian Azerbaijanis 2031:are also in Q-M242. 1903:United Arab Emirates 1366:language of the Huns 381:F1096, F1215 (Q1a1) 168:Ishtyak-Tokuz Tatars 32:Haplogroup Q (mtDNA) 18:Haplogroup Q (Y-DNA) 11088:National Geographic 10868:10.1038/nature02878 10860:2004Natur.431..302W 10811:2001PNAS...9810244W 10701:2007BMCEE...7..232S 10578:10.1038/nature08835 10570:2010Natur.463..757R 10442:10.1038/ejhg.2009.6 10023:Phil. Trans. R. Soc 9879:10.1038/nature14625 9871:2015Natur.523..455R 9772:10.1038/nature13025 9764:2014Natur.506..225R 9713:(3rd ed.), p. 204. 9437:2011PLoSO...624282C 9378:2013PLoSO...876748D 9284:10.1038/jhg.2011.64 9224:2012PLoSO...741252G 9121:2012PLoSO...734288H 8960:2012PLoSO...750794B 8644:2013PLoSO...856779K 8585:2013PLoSO...853731V 8357:2013PLoSO...875064G 8298:2009BMCEE...9..154F 8239:2014PLoSO...990414K 7844:2011BMCEE..11..288A 7775:2013PLoSO...856775B 7665:2012PLoSO...741252G 7603:2013PLoSO...876748D 7543:2012PLoSO...734288H 7327:2001PNAS...9810244W 7321:(18): 10244–10249. 7216:(2020) 28:636–645. 7165:2012PLoSO...736437H 7017:2014PLoSO...9j3772W 6498:2015PLoSO..1025676Z 6223:10.1038/ejhg.2009.6 6078:10.1038/jhg.2011.64 5962:2013PLoSO...876748D 5599:10.1038/nature02878 5591:2004Natur.431..302W 5381:2012PLoSO...740007P 5137:2015PLoSO..1044223G 5062:10.1038/jhg.2012.67 4975:2013PLoSO...871390B 4758:10.1038/nature08835 4750:2010Natur.463..757R 4394:2015PLoSO..1016573O 3881:2017BMCEE..17S..18B 3635:Y-DNA by population 3550: 3088:Y-DNA backbone tree 2876:Yeniseian languages 2299:Belvedere Marittimo 1063:37.3% (181/485) in 847:(under Q-MEH2) and 651:, L314, L606, L612 347:The 2015 ISOGG tree 315:paths challenging. 108:Highest frequencies 10751:10.1002/humu.20077 10029:(1660): 20130378. 9961:10.1002/ajhb.22604 9639:10.1002/humu.20077 8728:Hungarian Bukovina 7894:Eur. J. Hum. Genet 6451:10.1002/ajhb.22604 6273:10.1002/ajhb.23194 6211:Eur. J. Hum. Genet 6194:(1): 87–104. 2000. 5192:10.1002/ajpa.21270 4832:2014-12-18 at the 4673:10.1002/ajpa.20883 4590:10.1101/gr.7172008 4536:2011-07-11 at the 4241:Lev A. Zhivotovsky 4237:Tatiana M. Karafet 3675:10.1002/humu.22468 3401: 3182:Y-chromosomal Adam 1931:who belong to the 1749:, whereas Karafet 1735:Sar-e Pol Province 1653:tribe in northern 1347:Altai-Sayan region 1095:15.2% (25/165) in 1074:31.2% (50/160) in 1019:Indigenous peoples 1001:Census data (2010) 986:Native American ‡ 970:Q-P36* (xM3) 0.2% 627:, M143, L714, L716 507:F835, L940 (Q1a2b) 407:M25, M143 (Q1a1b) 325:phylogenetic trees 319:Phylogenetic trees 240:, the other being 100:Defining mutations 11056:978-0-549-80966-1 11020:978-0-8129-7146-0 10785:978-0-8129-7146-0 10617:10.1159/000093774 10564:(7282): 757–762. 9865:(7561): 455–458. 9815:(7487): 162–163. 9758:(7487): 225–229. 8093:978-0-549-80966-1 7991:Am. J. Hum. Genet 7723:10.1159/000093774 5086:Forensic Sci. Int 4794:Forensic Sci. Int 4744:(7282): 757–762. 4622:"Y-DNA Haplotree" 4245:Michael F. Hammer 4233:Zegura Stephen L. 4046:YFull YTree v4.02 3846: 3845: 3808:, 2017, "K-M2335" 3806:YFull YTree v5.08 3756:Haplogroup T-M184 3624: 3623: 3569: 3559: 3549: 3540: 3528: 3517: 3509: 3497: 3489: 3482: 3475: 3468: 3413: 3332: 3324: 3315: 3245: 3229: 3212: 3195: 3167: 3166: 2727:Afontova-Gora-2, 2674:of North-Western 2506:Golestan Province 2016:, the capital of 1982:, the capital of 1861:Azarbaijan Gharbi 1595:, 2.5% (1/40) in 1546:Gyeonggi Province 1405:Chukchi Peninsula 1362:Na-Dené languages 1303:. Also, Todjins ( 1102:9.7% (20/206) in 1010: 1009: 815:male lineages in 189: 188: 156:Greenlandic Inuit 16:(Redirected from 11126: 11067: 11065: 11063: 11039: 11037: 11035: 11003: 10993: 10968: 10958: 10925: 10887: 10842: 10832: 10822: 10789: 10778:. Random House. 10770: 10732: 10722: 10712: 10679: 10669: 10636: 10599: 10589: 10548: 10510: 10492: 10475:(Pt 4): 480–95. 10463: 10453: 10420: 10410: 10385: 10375: 10342: 10332: 10299: 10261: 10251: 10227: 10217: 10192: 10182: 10149: 10111: 10101: 10091: 10057: 10056: 10046: 10014: 10008: 10005: 9999: 9996: 9990: 9987: 9981: 9980: 9943: 9937: 9934: 9925: 9924: 9921:"Q-YP1500 YTree" 9917: 9911: 9907: 9901: 9900: 9890: 9849: 9843: 9842: 9824: 9800: 9794: 9793: 9783: 9743: 9737: 9724: 9718: 9707: 9701: 9700: 9690: 9666: 9660: 9658: 9621: 9615: 9614: 9612: 9611: 9592: 9586: 9585: 9575: 9543: 9537: 9526: 9520: 9519: 9509: 9499: 9475: 9469: 9468: 9458: 9448: 9416: 9410: 9409: 9399: 9389: 9357: 9338: 9337: 9327: 9303: 9297: 9296: 9286: 9262: 9256: 9255: 9245: 9235: 9202: 9196: 9195: 9159: 9153: 9152: 9142: 9132: 9100: 9094: 9091: 9085: 9084: 9074: 9042: 9036: 9035: 8999: 8993: 8991: 8981: 8971: 8939: 8933: 8932: 8922: 8890: 8884: 8883: 8871: 8862: 8861: 8854: 8848: 8847: 8840: 8834: 8833: 8826: 8820: 8819: 8812: 8806: 8801: 8795: 8792: 8786: 8785: 8778: 8772: 8766: 8755: 8754: 8747: 8741: 8736: 8730: 8725: 8719: 8718: 8682: 8676: 8675: 8665: 8655: 8623: 8617: 8616: 8606: 8596: 8564: 8558: 8557: 8550: 8544: 8543: 8536: 8530: 8529: 8519: 8487: 8481: 8480: 8473: 8467: 8466: 8430: 8424: 8423: 8395: 8389: 8388: 8378: 8368: 8336: 8330: 8329: 8319: 8309: 8277: 8271: 8270: 8260: 8250: 8218: 8212: 8211: 8201: 8169: 8154: 8153: 8143: 8111: 8105: 8104: 8102: 8100: 8077: 8071: 8070: 8034: 8025: 8024: 8014: 7982: 7976: 7975: 7965: 7955: 7931: 7920: 7919: 7909: 7885: 7876: 7875: 7865: 7855: 7823: 7817: 7813: 7807: 7806: 7796: 7786: 7754: 7743: 7742: 7706: 7697: 7696: 7686: 7676: 7644: 7635: 7634: 7624: 7614: 7581: 7575: 7574: 7564: 7554: 7521: 7515: 7514: 7504: 7472: 7466: 7465: 7429: 7423: 7419: 7413: 7412: 7402: 7370: 7359: 7358: 7348: 7338: 7305: 7288: 7287: 7275: 7269: 7268: 7258: 7241:(8): 1046–1050. 7226: 7220: 7206: 7197: 7196: 7186: 7176: 7144: 7135: 7134: 7116: 7087: 7076: 7075: 7066:(1): e260–e261. 7055: 7049: 7048: 7038: 7028: 6996: 6987: 6986: 6976: 6944: 6931: 6930: 6912: 6886: 6877: 6866: 6865: 6855: 6838:(4): 2431–2439. 6823: 6817: 6806: 6800: 6796: 6790: 6789: 6753: 6747: 6746: 6710: 6704: 6703: 6693: 6684:(8): 1761–1778. 6669: 6663: 6662: 6652: 6628: 6615: 6614: 6578: 6572: 6571: 6550: 6539: 6536: 6530: 6529: 6519: 6509: 6477: 6471: 6470: 6430: 6424: 6423: 6409: 6391: 6382: 6376: 6375: 6365: 6341: 6335: 6334: 6324: 6307:(9): 1013–1015. 6292: 6286: 6285: 6275: 6251: 6245: 6244: 6234: 6202: 6196: 6195: 6183: 6177: 6174: 6168: 6165: 6159: 6155: 6149: 6148: 6112: 6106: 6097: 6091: 6090: 6080: 6056: 6043: 6042: 6032: 6000: 5994: 5993: 5983: 5973: 5941: 5922: 5921: 5919: 5918: 5909:. Archived from 5903: 5892: 5891: 5881: 5871: 5847: 5832: 5831: 5821: 5812:(8): 1833–1844. 5797: 5788: 5787: 5777: 5767: 5743: 5732: 5731: 5721: 5689: 5674: 5673: 5636: 5623: 5618: 5574: 5563: 5562: 5552: 5528: 5519: 5518: 5481: 5472: 5469: 5459: 5427: 5418: 5412: 5402: 5392: 5360: 5354: 5353: 5351: 5327: 5321: 5320: 5300: 5294: 5293: 5275: 5247: 5241: 5239: 5222:(6): e192–e195. 5211: 5205: 5203: 5175: 5169: 5168: 5158: 5148: 5131:(12): e0144223. 5116: 5110: 5109: 5092:(2–3): 198–203. 5081: 5075: 5074: 5064: 5040: 5034: 5033: 5024:(1): e310–e311. 5013: 5007: 5006: 4996: 4986: 4954: 4931: 4929: 4919: 4909: 4885: 4879: 4878: 4842: 4836: 4824: 4818: 4817: 4789: 4780: 4779: 4769: 4729: 4720: 4719: 4717: 4716: 4701: 4695: 4694: 4684: 4652: 4646: 4635: 4629: 4625: 4618: 4612: 4611: 4601: 4569: 4563: 4562: 4557:. Archived from 4546: 4540: 4528: 4522: 4521: 4511: 4471: 4465: 4464: 4462: 4461: 4446: 4440: 4435: 4426: 4425: 4415: 4405: 4373: 4364: 4363: 4345: 4321: 4312: 4311: 4274: 4259: 4254: 4248: 4230: 4224: 4223: 4213: 4181: 4168: 4167: 4131: 4118: 4117: 4107: 4097: 4073: 4062: 4057: 4048: 4043: 4034: 4033: 4023: 3999: 3976: 3975: 3969: 3968: 3955: 3929: 3919: 3913: 3912: 3902: 3892: 3859: 3836: 3833: 3827: 3824: 3818: 3796: 3790: 3787: 3781: 3778: 3772: 3769: 3763: 3752: 3746: 3743: 3737: 3734: 3728: 3725: 3719: 3716: 3710: 3701: 3695: 3694: 3658: 3565: 3555: 3543: 3535: 3523: 3513: 3504: 3493: 3485: 3478: 3471: 3464: 3409: 3328: 3319: 3311: 3241: 3225: 3208: 3191: 3175: 3162: 3159: 3153: 3141: 3140: 3133: 3116: 3109: 3102: 3093: 3092: 2772:(West Mongolia) 2306:Ashkenazi Jewish 2287:Mazara del Vallo 2075:, about 2.2% of 2067:(Poland), 2% of 1802:Jowzjan Province 1727:Jawzjan Province 1645:(2/11) and 7.1% 1612:Ho Chi Minh City 1376:(6.3%, Q-M346), 928: 927: 865:Na-Dené speakers 823:by crossing the 762:L214, L215, M378 537:L275, L314 (Q2) 289: 286:Reverse 5′→ 3′: 283: 280:Forward 5′→ 3′: 223:Northern Siberia 180:Mon-Khmer people 49: 37: 36: 21: 11134: 11133: 11129: 11128: 11127: 11125: 11124: 11123: 11104: 11103: 11075: 11070: 11061: 11059: 11057: 11033: 11031: 11021: 10854:(7006): 302–5. 10805:(18): 10244–9. 10786: 10436:(10): 1260–73. 10065: 10060: 10015: 10011: 10006: 10002: 9997: 9993: 9988: 9984: 9944: 9940: 9935: 9928: 9919: 9918: 9914: 9908: 9904: 9850: 9846: 9822:10.1038/506162a 9801: 9797: 9744: 9740: 9725: 9721: 9708: 9704: 9667: 9663: 9622: 9618: 9609: 9607: 9594: 9593: 9589: 9544: 9540: 9534:Genome Research 9527: 9523: 9476: 9472: 9417: 9413: 9358: 9341: 9318:(12): 804–811. 9304: 9300: 9263: 9259: 9203: 9199: 9160: 9156: 9101: 9097: 9092: 9088: 9043: 9039: 9000: 8996: 8940: 8936: 8899:Eur J Hum Genet 8891: 8887: 8872: 8865: 8856: 8855: 8851: 8842: 8841: 8837: 8828: 8827: 8823: 8814: 8813: 8809: 8802: 8798: 8793: 8789: 8780: 8779: 8775: 8767: 8758: 8749: 8748: 8744: 8737: 8733: 8726: 8722: 8683: 8679: 8624: 8620: 8565: 8561: 8552: 8551: 8547: 8538: 8537: 8533: 8488: 8484: 8475: 8474: 8470: 8431: 8427: 8396: 8392: 8337: 8333: 8278: 8274: 8219: 8215: 8170: 8157: 8112: 8108: 8098: 8096: 8094: 8078: 8074: 8035: 8028: 7983: 7979: 7932: 7923: 7886: 7879: 7824: 7820: 7814: 7810: 7755: 7746: 7707: 7700: 7645: 7638: 7582: 7578: 7522: 7518: 7473: 7469: 7430: 7426: 7420: 7416: 7371: 7362: 7306: 7291: 7276: 7272: 7235:Eur J Hum Genet 7227: 7223: 7207: 7200: 7145: 7138: 7088: 7079: 7056: 7052: 6997: 6990: 6965:10.1038/ng.3559 6953:Nature Genetics 6945: 6934: 6884: 6878: 6869: 6824: 6820: 6814:Nature Genetics 6807: 6803: 6797: 6793: 6754: 6750: 6715:Int J Legal Med 6711: 6707: 6678:Mol. Biol. Evol 6670: 6666: 6629: 6618: 6583:Int J Legal Med 6579: 6575: 6551: 6542: 6537: 6533: 6492:(5): e0125676. 6478: 6474: 6431: 6427: 6394:Mol. Biol. Evol 6389: 6383: 6379: 6350:Mol. Biol. Evol 6342: 6338: 6293: 6289: 6252: 6248: 6217:(10): 1260–73. 6203: 6199: 6185: 6184: 6180: 6175: 6171: 6166: 6162: 6156: 6152: 6113: 6109: 6098: 6094: 6057: 6046: 6001: 5997: 5942: 5925: 5916: 5914: 5905: 5904: 5895: 5848: 5835: 5806:Mol. Biol. Evol 5798: 5791: 5744: 5735: 5690: 5677: 5637: 5626: 5585:(7006): 302–5. 5575: 5566: 5529: 5522: 5482: 5475: 5428: 5421: 5361: 5357: 5328: 5324: 5301: 5297: 5248: 5244: 5212: 5208: 5176: 5172: 5119:Grugni (2015). 5117: 5113: 5082: 5078: 5041: 5037: 5014: 5010: 4955: 4934: 4886: 4882: 4847:Int J Legal Med 4843: 4839: 4834:Wayback Machine 4825: 4821: 4790: 4783: 4730: 4723: 4714: 4712: 4703: 4702: 4698: 4653: 4649: 4636: 4632: 4620: 4619: 4615: 4578:Genome Research 4570: 4566: 4555:Family Tree DNA 4549:Krahn, Thomas. 4547: 4543: 4538:Wayback Machine 4529: 4525: 4472: 4468: 4459: 4457: 4447: 4443: 4436: 4429: 4388:(1): e0116573. 4374: 4367: 4322: 4315: 4275: 4262: 4255: 4251: 4231: 4227: 4182: 4171: 4132: 4121: 4074: 4065: 4058: 4051: 4044: 4037: 4000: 3979: 3966: 3964: 3927: 3920: 3916: 3860: 3856: 3852: 3847: 3842: 3841: 3840: 3839: 3834: 3830: 3825: 3821: 3797: 3793: 3788: 3784: 3779: 3775: 3770: 3766: 3753: 3749: 3744: 3740: 3735: 3731: 3726: 3722: 3717: 3713: 3702: 3698: 3659: 3655: 3650: 3644: 3625: 3168: 3163: 3157: 3154: 3151: 3142: 3138: 3126: 3120: 3090: 3085: 3023: 3018: 2979:Siberian Tatars 2954: 2949: 2831:Pengyang County 2721: 2715: 2688:Central America 2668:Japanese people 2372:. Important in 2353: 2318: 2263:Southern Europe 2260: 2258:Southern Europe 2204: 2140:Northern Europe 2136: 2134:Northern Europe 2045: 2037: 2024:are in Q-M242. 2010:Nepalese people 1953:Iranian Plateau 1945: 1818: 1663: 1628:Red River Delta 1602:In the case of 1581: 1508:northeast China 1464:northwest China 1429: 1395:, and 33.3% of 1359:Native American 1343:Sayan Mountains 1320:Siberian Tatars 1258: 1134: 1015: 861: 809: 799: 794: 777: 734:L56, L57, M346 716:M120, N14, M265 672: 586: 477:L804 (Q1a2a1a2) 467:M19 (Q1a2a1a1a) 349: 321: 296: 287: 281: 265: 249:Altai Mountains 231: 184:tribes of Assam 164:Siberian Tatars 52: 35: 28: 23: 22: 15: 12: 11: 5: 11132: 11122: 11121: 11116: 11102: 11101: 11096: 11091: 11074: 11073:External links 11071: 11069: 11068: 11055: 11040: 11019: 11004: 10969: 10926: 10894:Human Genetics 10888: 10843: 10790: 10784: 10771: 10739:Human Mutation 10733: 10680: 10658:10.1086/499411 10637: 10611:(3): 132–143. 10605:Human Heredity 10600: 10549: 10517:Human Genetics 10511: 10464: 10421: 10386: 10364:10.1086/516757 10343: 10300: 10268:Human Genetics 10262: 10193: 10171:10.1086/377588 10150: 10118:Human Genetics 10112: 10066: 10064: 10061: 10059: 10058: 10009: 10000: 9991: 9982: 9955:(6): 813–821. 9938: 9926: 9912: 9902: 9844: 9795: 9738: 9719: 9702: 9661: 9627:Human Mutation 9616: 9587: 9558:(4): 873–882. 9538: 9521: 9490:(3): 661–673. 9470: 9411: 9372:(10): e76748. 9339: 9298: 9257: 9197: 9154: 9095: 9086: 9057:(6): 725–736. 9037: 8994: 8954:(12): e50794. 8934: 8885: 8863: 8849: 8835: 8821: 8807: 8796: 8787: 8773: 8756: 8742: 8731: 8720: 8693:(4): 519–534. 8677: 8618: 8559: 8545: 8531: 8502:(3): 358–367. 8482: 8468: 8425: 8406:(2): 187–192. 8390: 8351:(10): e75064. 8331: 8286:BMC Evol. Biol 8272: 8213: 8190:10.1086/499411 8184:(2): 202–221. 8155: 8126:(1): 121–126. 8106: 8092: 8072: 8026: 7977: 7921: 7877: 7818: 7808: 7744: 7717:(3): 132–143. 7711:Human Heredity 7698: 7636: 7597:(10): e76748. 7576: 7516: 7493:10.1086/323299 7487:(3): 615–628. 7467: 7434:Ann. Hum. Biol 7424: 7414: 7391:10.1086/377589 7385:(3): 700–705. 7360: 7289: 7270: 7221: 7198: 7136: 7077: 7050: 7011:(8): e103772. 6988: 6959:(6): 593–599. 6932: 6895:(4): 480–495. 6867: 6818: 6801: 6791: 6764:(4): 589–599. 6748: 6705: 6664: 6616: 6573: 6562:(1): 146–156. 6558:(in Chinese). 6540: 6531: 6472: 6425: 6377: 6356:(1): 717–727. 6336: 6287: 6246: 6197: 6178: 6169: 6160: 6150: 6123:(5): 591–604. 6107: 6092: 6071:(8): 583–588. 6044: 6015:(2): 229–246. 5995: 5956:(10): e76748. 5923: 5893: 5833: 5789: 5733: 5710:10.1086/516757 5704:(5): 884–894. 5675: 5642:Human Genetics 5624: 5564: 5520: 5493:(3): 334–353. 5487:Human Genetics 5473: 5448:10.1086/338457 5442:(1): 192–206. 5419: 5355: 5342:(1): 252–254. 5322: 5311:(1): 431–432. 5295: 5242: 5206: 5170: 5111: 5076: 5035: 5008: 4932: 4880: 4853:(4): 673–680. 4837: 4819: 4781: 4721: 4696: 4647: 4630: 4613: 4564: 4561:on 2015-08-15. 4541: 4523: 4492:10.1086/377589 4486:(3): 700–705. 4466: 4441: 4427: 4365: 4336:(8): 818–824. 4313: 4286:(5): 675–687. 4260: 4249: 4225: 4202:10.1086/377588 4196:(3): 524–539. 4169: 4142:(6): 761–789. 4119: 4082:BMC Evol. Biol 4063: 4049: 4035: 3977: 3938:(3): 583–592. 3914: 3853: 3851: 3848: 3844: 3843: 3838: 3837: 3828: 3819: 3791: 3782: 3773: 3764: 3747: 3738: 3729: 3720: 3711: 3696: 3663:Human Mutation 3652: 3651: 3646: 3645: 3643: 3642: 3637: 3631: 3630: 3627: 3626: 3622: 3621: 3619: 3614: 3609: 3606: 3605: 3600: 3598: 3593: 3591: 3586: 3581: 3576: 3573: 3572: 3570: 3563: 3561: 3553: 3551: 3541: 3533: 3530: 3529: 3521: 3519: 3510: 3502: 3499: 3498: 3491: 3483: 3476: 3469: 3462: 3460: 3453: 3447: 3445: 3439: 3433: 3431: 3425: 3419: 3416: 3415: 3406: 3399: 3397: 3391: 3385: 3382: 3381: 3376: 3371: 3368: 3367: 3362: 3357: 3354: 3353: 3348: 3343: 3340: 3339: 3333: 3325: 3316: 3309: 3306: 3305: 3300: 3295: 3293: 3288: 3283: 3280: 3279: 3274: 3269: 3266: 3265: 3260: 3255: 3252: 3251: 3246: 3239: 3236: 3235: 3230: 3223: 3220: 3219: 3213: 3206: 3203: 3202: 3196: 3189: 3186: 3185: 3178: 3173: 3170: 3169: 3165: 3164: 3145: 3143: 3136: 3131: 3128: 3127: 3119: 3118: 3111: 3104: 3096: 3089: 3086: 3084: 3083: 3078: 3073: 3068: 3063: 3058: 3053: 3048: 3043: 3038: 3033: 3028: 3024: 3022: 3019: 3017: 3016: 3011: 3006: 3001: 2996: 2991: 2989:Chukchi people 2986: 2981: 2976: 2971: 2966: 2961: 2955: 2953: 2950: 2948: 2945: 2944: 2943: 2942: 2941: 2940: 2939: 2885: 2884: 2883: 2862: 2861: 2860: 2838: 2828: 2827: 2826: 2823: 2801: 2800: 2799: 2782: 2781: 2780: 2767: 2766: 2765: 2755: 2748:Clovis culture 2740:North America 2738: 2737: 2736: 2717:Main article: 2714: 2711: 2710: 2709: 2708: 2707: 2706: 2705: 2704: 2703: 2684:Sephardic Jews 2680:Ashkenazi Jews 2641: 2640: 2639: 2638: 2637: 2625: 2624: 2623: 2622: 2621: 2618: 2615: 2607:, such as the 2597:) — Common in 2532: 2493: 2426:Saqqaq culture 2401: 2352: 2349: 2317: 2314: 2297:, and 3.7% in 2259: 2256: 2220:United Kingdom 2208:Western Europe 2203: 2202:Western Europe 2200: 2135: 2132: 2049:Eastern Europe 2044: 2041: 2036: 2033: 1944: 1941: 1845:Persian people 1821:Southwest Asia 1817: 1816:Southwest Asia 1814: 1662: 1659: 1585:Southeast Asia 1580: 1579:Southeast Asia 1577: 1428: 1425: 1423:in Kamchatka. 1397:Chukchi people 1324:Ishtyako-Tokuz 1313:Altai Republic 1293:Altai Republic 1257: 1254: 1166:Chukchi people 1133: 1130: 1129: 1128: 1121: 1114: 1107: 1100: 1093: 1086: 1079: 1072: 1061: 1054: 1048: 1041: 1014: 1011: 1008: 1007: 997:Source : 994: 993: 990: 987: 983: 982: 979: 976: 972: 971: 968: 965: 961: 960: 957: 954: 950: 949: 946: 943: 939: 938: 935: 932: 908:Chukchi people 860: 857: 798: 795: 793: 790: 776: 773: 772: 771: 770: 769: 768: 767: 766: 765: 764: 763: 747: 746: 745: 744: 743: 727: 726: 725: 717: 671: 668: 667: 666: 665: 664: 663: 662: 661: 660: 659: 658: 646: 645: 644: 639: 634: 628: 622: 585: 582: 581: 580: 579: 578: 577: 576: 575: 574: 566: 565: 564: 563: 562: 530: 529: 528: 527: 526: 525: 524: 508: 500: 499: 498: 497: 496: 495:L330 (Q1a2a1c) 488: 480: 479: 478: 470: 469: 468: 459:M3 (Q1a2a1a1) 420: 419: 418: 417: 416: 400: 399: 398: 389:NWT01 (Q1a1a) 348: 345: 320: 317: 295: 292: 291: 290: 284: 278: 275: 272: 264: 261: 230: 227: 187: 186: 128:Karakalpakstan 109: 105: 104: 103:M242 rs8179021 101: 97: 96: 90: 86: 85: 80: 76: 75: 66: 62: 61: 58: 54: 53: 50: 42: 41: 26: 9: 6: 4: 3: 2: 11131: 11120: 11117: 11115: 11112: 11111: 11109: 11100: 11097: 11095: 11092: 11090: 11089: 11084: 11080: 11077: 11076: 11058: 11052: 11048: 11047: 11041: 11030: 11026: 11022: 11016: 11012: 11011: 11005: 11001: 10997: 10992: 10987: 10984:(1): 164–75. 10983: 10979: 10975: 10970: 10966: 10962: 10957: 10952: 10948: 10944: 10941:(4): 873–82. 10940: 10936: 10932: 10927: 10923: 10919: 10915: 10911: 10907: 10903: 10900:(6): 582–90. 10899: 10895: 10889: 10885: 10881: 10877: 10873: 10869: 10865: 10861: 10857: 10853: 10849: 10844: 10840: 10836: 10831: 10826: 10821: 10816: 10812: 10808: 10804: 10800: 10796: 10791: 10787: 10781: 10777: 10772: 10768: 10764: 10760: 10756: 10752: 10748: 10745:(3): 248–60. 10744: 10740: 10734: 10730: 10726: 10721: 10716: 10711: 10706: 10702: 10698: 10694: 10690: 10686: 10681: 10677: 10673: 10668: 10663: 10659: 10655: 10652:(2): 202–21. 10651: 10647: 10643: 10638: 10634: 10630: 10626: 10622: 10618: 10614: 10610: 10606: 10601: 10597: 10593: 10588: 10583: 10579: 10575: 10571: 10567: 10563: 10559: 10555: 10550: 10546: 10542: 10538: 10534: 10530: 10526: 10523:(3): 334–53. 10522: 10518: 10512: 10508: 10504: 10500: 10496: 10491: 10486: 10482: 10478: 10474: 10470: 10465: 10461: 10457: 10452: 10447: 10443: 10439: 10435: 10431: 10427: 10422: 10418: 10414: 10409: 10404: 10400: 10396: 10392: 10387: 10383: 10379: 10374: 10369: 10365: 10361: 10358:(5): 884–94. 10357: 10353: 10349: 10344: 10340: 10336: 10331: 10326: 10322: 10318: 10314: 10310: 10306: 10301: 10297: 10293: 10289: 10285: 10281: 10277: 10274:(2): 127–48. 10273: 10269: 10263: 10259: 10255: 10250: 10245: 10242:(3): 374–86. 10241: 10237: 10233: 10225: 10221: 10216: 10211: 10208:(3): 374–86. 10207: 10203: 10199: 10194: 10190: 10186: 10181: 10176: 10172: 10168: 10165:(3): 524–39. 10164: 10160: 10156: 10151: 10147: 10143: 10139: 10135: 10131: 10127: 10124:(4): 354–65. 10123: 10119: 10113: 10109: 10105: 10100: 10095: 10090: 10085: 10081: 10077: 10073: 10068: 10067: 10054: 10050: 10045: 10040: 10036: 10032: 10028: 10024: 10020: 10013: 10004: 9995: 9986: 9978: 9974: 9970: 9966: 9962: 9958: 9954: 9950: 9942: 9933: 9931: 9922: 9916: 9906: 9898: 9894: 9889: 9884: 9880: 9876: 9872: 9868: 9864: 9860: 9856: 9848: 9840: 9836: 9832: 9828: 9823: 9818: 9814: 9810: 9806: 9799: 9791: 9787: 9782: 9777: 9773: 9769: 9765: 9761: 9757: 9753: 9749: 9742: 9736: 9732: 9728: 9723: 9716: 9712: 9706: 9698: 9694: 9689: 9684: 9681:(1): 717–27. 9680: 9676: 9672: 9665: 9656: 9652: 9648: 9644: 9640: 9636: 9633:(3): 248–60. 9632: 9628: 9620: 9606:on 2010-06-22 9605: 9601: 9597: 9591: 9583: 9579: 9574: 9569: 9565: 9561: 9557: 9553: 9549: 9542: 9535: 9531: 9525: 9517: 9513: 9508: 9503: 9498: 9493: 9489: 9485: 9481: 9474: 9466: 9462: 9457: 9452: 9447: 9442: 9438: 9434: 9431:(8): e24282. 9430: 9426: 9422: 9415: 9407: 9403: 9398: 9393: 9388: 9383: 9379: 9375: 9371: 9367: 9363: 9356: 9354: 9352: 9350: 9348: 9346: 9344: 9335: 9331: 9326: 9321: 9317: 9313: 9309: 9302: 9294: 9290: 9285: 9280: 9276: 9272: 9268: 9261: 9253: 9249: 9244: 9239: 9234: 9229: 9225: 9221: 9218:(7): e41252. 9217: 9213: 9209: 9201: 9193: 9189: 9185: 9181: 9177: 9173: 9170:(5): 565–78. 9169: 9165: 9158: 9150: 9146: 9141: 9136: 9131: 9126: 9122: 9118: 9115:(3): e34288. 9114: 9110: 9106: 9099: 9090: 9082: 9078: 9073: 9068: 9064: 9060: 9056: 9052: 9048: 9041: 9033: 9029: 9025: 9021: 9017: 9013: 9010:(4): 354–65. 9009: 9005: 8998: 8989: 8985: 8980: 8975: 8970: 8965: 8961: 8957: 8953: 8949: 8945: 8938: 8930: 8926: 8921: 8916: 8912: 8908: 8904: 8900: 8896: 8889: 8881: 8877: 8870: 8868: 8859: 8853: 8845: 8839: 8831: 8825: 8817: 8811: 8805: 8800: 8791: 8783: 8777: 8771: 8765: 8763: 8761: 8752: 8746: 8740: 8735: 8729: 8724: 8716: 8712: 8708: 8704: 8700: 8696: 8692: 8688: 8681: 8673: 8669: 8664: 8659: 8654: 8649: 8645: 8641: 8638:(3): e56779. 8637: 8633: 8629: 8622: 8614: 8610: 8605: 8600: 8595: 8590: 8586: 8582: 8579:(1): e53731. 8578: 8574: 8570: 8563: 8555: 8549: 8541: 8535: 8527: 8523: 8518: 8513: 8509: 8505: 8501: 8497: 8493: 8486: 8478: 8472: 8464: 8460: 8456: 8452: 8448: 8444: 8441:(8): 1132–6. 8440: 8436: 8429: 8421: 8417: 8413: 8409: 8405: 8401: 8394: 8386: 8382: 8377: 8372: 8367: 8362: 8358: 8354: 8350: 8346: 8342: 8335: 8327: 8323: 8318: 8313: 8308: 8303: 8299: 8295: 8291: 8287: 8283: 8276: 8268: 8264: 8259: 8254: 8249: 8244: 8240: 8236: 8233:(3): e90414. 8232: 8228: 8224: 8217: 8209: 8205: 8200: 8195: 8191: 8187: 8183: 8179: 8175: 8168: 8166: 8164: 8162: 8160: 8151: 8147: 8142: 8137: 8133: 8129: 8125: 8121: 8117: 8110: 8095: 8089: 8085: 8084: 8076: 8068: 8064: 8060: 8056: 8052: 8048: 8045:(2): 127–48. 8044: 8040: 8033: 8031: 8022: 8018: 8013: 8008: 8004: 8000: 7997:(4): 873–82. 7996: 7992: 7988: 7981: 7973: 7969: 7964: 7959: 7954: 7949: 7945: 7941: 7937: 7930: 7928: 7926: 7917: 7913: 7908: 7903: 7900:(3): 374–86. 7899: 7895: 7891: 7884: 7882: 7873: 7869: 7864: 7859: 7854: 7849: 7845: 7841: 7837: 7833: 7829: 7822: 7812: 7804: 7800: 7795: 7790: 7785: 7780: 7776: 7772: 7769:(2): e56775. 7768: 7764: 7760: 7753: 7751: 7749: 7740: 7736: 7732: 7728: 7724: 7720: 7716: 7712: 7705: 7703: 7694: 7690: 7685: 7680: 7675: 7670: 7666: 7662: 7659:(7): e41252. 7658: 7654: 7650: 7643: 7641: 7632: 7628: 7623: 7618: 7613: 7608: 7604: 7600: 7596: 7592: 7588: 7580: 7572: 7568: 7563: 7558: 7553: 7548: 7544: 7540: 7537:(3): e34288. 7536: 7532: 7528: 7520: 7512: 7508: 7503: 7498: 7494: 7490: 7486: 7482: 7478: 7471: 7463: 7459: 7455: 7451: 7447: 7443: 7439: 7435: 7428: 7418: 7410: 7406: 7401: 7396: 7392: 7388: 7384: 7380: 7376: 7369: 7367: 7365: 7356: 7352: 7347: 7342: 7337: 7332: 7328: 7324: 7320: 7316: 7312: 7304: 7302: 7300: 7298: 7296: 7294: 7285: 7281: 7274: 7266: 7262: 7257: 7252: 7248: 7244: 7240: 7236: 7232: 7225: 7219: 7215: 7211: 7205: 7203: 7194: 7190: 7185: 7180: 7175: 7170: 7166: 7162: 7159:(5): e36437. 7158: 7154: 7150: 7143: 7141: 7132: 7128: 7124: 7120: 7115: 7110: 7106: 7102: 7099:(1): 93–114. 7098: 7094: 7086: 7084: 7082: 7073: 7069: 7065: 7061: 7054: 7046: 7042: 7037: 7032: 7027: 7022: 7018: 7014: 7010: 7006: 7002: 6995: 6993: 6984: 6980: 6975: 6970: 6966: 6962: 6958: 6954: 6950: 6943: 6941: 6939: 6937: 6928: 6924: 6920: 6916: 6911: 6906: 6902: 6898: 6894: 6890: 6883: 6876: 6874: 6872: 6863: 6859: 6854: 6849: 6845: 6841: 6837: 6833: 6829: 6822: 6815: 6811: 6805: 6795: 6787: 6783: 6779: 6775: 6771: 6767: 6763: 6759: 6752: 6744: 6740: 6736: 6732: 6728: 6724: 6720: 6716: 6709: 6701: 6697: 6692: 6687: 6683: 6679: 6675: 6668: 6660: 6656: 6651: 6646: 6642: 6638: 6634: 6627: 6625: 6623: 6621: 6612: 6608: 6604: 6600: 6596: 6592: 6588: 6584: 6577: 6569: 6565: 6561: 6557: 6549: 6547: 6545: 6535: 6527: 6523: 6518: 6513: 6508: 6503: 6499: 6495: 6491: 6487: 6483: 6476: 6468: 6464: 6460: 6456: 6452: 6448: 6445:(6): 813–21. 6444: 6440: 6439:Am J Hum Biol 6436: 6429: 6421: 6417: 6413: 6408: 6403: 6399: 6395: 6388: 6381: 6373: 6369: 6364: 6359: 6355: 6351: 6347: 6340: 6332: 6328: 6323: 6318: 6314: 6310: 6306: 6302: 6298: 6291: 6283: 6279: 6274: 6269: 6266:(6): e23194. 6265: 6261: 6257: 6250: 6242: 6238: 6233: 6228: 6224: 6220: 6216: 6212: 6208: 6201: 6193: 6189: 6182: 6173: 6164: 6154: 6146: 6142: 6138: 6134: 6130: 6126: 6122: 6118: 6111: 6105: 6103: 6096: 6088: 6084: 6079: 6074: 6070: 6066: 6062: 6055: 6053: 6051: 6049: 6040: 6036: 6031: 6026: 6022: 6018: 6014: 6010: 6006: 5999: 5991: 5987: 5982: 5977: 5972: 5967: 5963: 5959: 5955: 5951: 5947: 5940: 5938: 5936: 5934: 5932: 5930: 5928: 5913:on 2008-09-22 5912: 5908: 5902: 5900: 5898: 5889: 5885: 5880: 5875: 5870: 5865: 5861: 5857: 5853: 5846: 5844: 5842: 5840: 5838: 5829: 5825: 5820: 5815: 5811: 5807: 5803: 5796: 5794: 5785: 5781: 5776: 5771: 5766: 5761: 5757: 5753: 5749: 5742: 5740: 5738: 5729: 5725: 5720: 5715: 5711: 5707: 5703: 5699: 5695: 5688: 5686: 5684: 5682: 5680: 5671: 5667: 5663: 5659: 5655: 5651: 5648:(6): 582–90. 5647: 5643: 5635: 5633: 5631: 5629: 5622: 5616: 5612: 5608: 5604: 5600: 5596: 5592: 5588: 5584: 5580: 5573: 5571: 5569: 5560: 5556: 5551: 5546: 5542: 5538: 5534: 5527: 5525: 5516: 5512: 5508: 5504: 5500: 5496: 5492: 5488: 5480: 5478: 5467: 5463: 5458: 5453: 5449: 5445: 5441: 5437: 5433: 5426: 5424: 5416: 5410: 5406: 5401: 5396: 5391: 5386: 5382: 5378: 5375:(7): e40007. 5374: 5370: 5366: 5359: 5350: 5345: 5341: 5337: 5333: 5326: 5318: 5314: 5310: 5306: 5299: 5291: 5287: 5283: 5279: 5274: 5269: 5265: 5261: 5257: 5253: 5246: 5237: 5233: 5229: 5225: 5221: 5217: 5210: 5201: 5197: 5193: 5189: 5185: 5181: 5174: 5166: 5162: 5157: 5152: 5147: 5142: 5138: 5134: 5130: 5126: 5122: 5115: 5107: 5103: 5099: 5095: 5091: 5087: 5080: 5072: 5068: 5063: 5058: 5055:(9): 568–74. 5054: 5050: 5049:J. Hum. Genet 5046: 5039: 5031: 5027: 5023: 5019: 5012: 5004: 5000: 4995: 4990: 4985: 4980: 4976: 4972: 4969:(8): e71390. 4968: 4964: 4960: 4953: 4951: 4949: 4947: 4945: 4943: 4941: 4939: 4937: 4927: 4923: 4918: 4913: 4908: 4903: 4899: 4895: 4891: 4884: 4876: 4872: 4868: 4864: 4860: 4856: 4852: 4848: 4841: 4835: 4831: 4828: 4823: 4815: 4811: 4807: 4803: 4799: 4795: 4788: 4786: 4777: 4773: 4768: 4763: 4759: 4755: 4751: 4747: 4743: 4739: 4735: 4728: 4726: 4711:on 2009-11-04 4710: 4706: 4700: 4692: 4688: 4683: 4678: 4674: 4670: 4667:(4): 412–24. 4666: 4662: 4658: 4651: 4643: 4640: 4634: 4628: 4623: 4617: 4609: 4605: 4600: 4595: 4591: 4587: 4583: 4579: 4575: 4568: 4560: 4556: 4552: 4545: 4539: 4535: 4532: 4531:Proposed Tree 4527: 4519: 4515: 4510: 4505: 4501: 4497: 4493: 4489: 4485: 4481: 4477: 4470: 4456: 4452: 4445: 4439: 4434: 4432: 4423: 4419: 4414: 4409: 4404: 4399: 4395: 4391: 4387: 4383: 4379: 4372: 4370: 4361: 4357: 4353: 4349: 4344: 4339: 4335: 4331: 4327: 4320: 4318: 4309: 4305: 4301: 4297: 4293: 4289: 4285: 4281: 4273: 4271: 4269: 4267: 4265: 4258: 4253: 4246: 4242: 4238: 4234: 4229: 4221: 4217: 4212: 4207: 4203: 4199: 4195: 4191: 4187: 4180: 4178: 4176: 4174: 4165: 4161: 4157: 4153: 4149: 4145: 4141: 4137: 4136:Human Biology 4130: 4128: 4126: 4124: 4115: 4111: 4106: 4101: 4096: 4091: 4087: 4083: 4079: 4072: 4070: 4068: 4061: 4056: 4054: 4047: 4042: 4040: 4031: 4027: 4022: 4017: 4014:(1): 164–75. 4013: 4009: 4005: 3998: 3996: 3994: 3992: 3990: 3988: 3986: 3984: 3982: 3974: 3963: 3959: 3954: 3949: 3945: 3941: 3937: 3933: 3926: 3918: 3910: 3906: 3901: 3896: 3891: 3886: 3882: 3878: 3874: 3870: 3866: 3858: 3854: 3832: 3823: 3816: 3814: 3809: 3807: 3802: 3795: 3786: 3777: 3768: 3761: 3757: 3751: 3742: 3733: 3724: 3715: 3708: 3707: 3700: 3692: 3688: 3684: 3680: 3676: 3672: 3669:(2): 187–91. 3668: 3664: 3657: 3653: 3649: 3641: 3638: 3636: 3633: 3632: 3628: 3620: 3618: 3613: 3607: 3604: 3597: 3590: 3585: 3580: 3574: 3568: 3562: 3560: 3558: 3547: 3538: 3531: 3526: 3516: 3507: 3500: 3496: 3490: 3488: 3481: 3474: 3467: 3458: 3452: 3451: 3443: 3438: 3437: 3429: 3424: 3423: 3417: 3412: 3404: 3395: 3390: 3389: 3383: 3380: 3375: 3369: 3366: 3361: 3355: 3352: 3347: 3341: 3338: 3331: 3322: 3314: 3307: 3304: 3299: 3292: 3287: 3281: 3278: 3273: 3267: 3264: 3259: 3253: 3250: 3244: 3237: 3234: 3228: 3221: 3217: 3211: 3204: 3200: 3194: 3187: 3183: 3176: 3171: 3161: 3158:February 2021 3149: 3144: 3135: 3134: 3129: 3125: 3117: 3112: 3110: 3105: 3103: 3098: 3097: 3094: 3082: 3079: 3077: 3074: 3072: 3069: 3067: 3064: 3062: 3059: 3057: 3054: 3052: 3049: 3047: 3044: 3042: 3039: 3037: 3034: 3032: 3029: 3026: 3025: 3015: 3012: 3010: 3007: 3005: 3002: 3000: 2997: 2995: 2992: 2990: 2987: 2985: 2982: 2980: 2977: 2975: 2974:Selkup people 2972: 2970: 2967: 2965: 2962: 2960: 2959:Paleo-Indians 2957: 2956: 2937: 2932: 2928: 2924: 2920: 2916: 2912: 2908: 2904: 2900: 2899: 2897: 2894: 2890: 2886: 2881: 2877: 2873: 2869: 2868: 2866: 2863: 2858: 2854: 2850: 2846: 2845: 2843: 2840:Heigouliang, 2839: 2836: 2832: 2829: 2824: 2820: 2819: 2817: 2813: 2809: 2805: 2804: 2802: 2797: 2793: 2789: 2786: 2785: 2783: 2778: 2774: 2773: 2771: 2768: 2763: 2759: 2758:Kennewick Man 2756: 2753: 2749: 2745: 2742: 2741: 2739: 2734: 2730: 2729:Yenisei River 2726: 2725: 2723: 2722: 2720: 2701: 2700:Andean Region 2697: 2696:South America 2693: 2689: 2685: 2681: 2677: 2673: 2669: 2665: 2661: 2657: 2653: 2650: 2649: 2648:(L275, L314) 2647: 2646: 2642: 2635: 2634:Yemenite Jews 2631: 2630: 2626: 2619: 2616: 2614: 2610: 2606: 2605:South America 2602: 2601: 2600: 2596: 2592: 2591: 2587: 2586: 2584: 2581: 2580: 2578: 2574: 2570: 2566: 2562: 2558: 2554: 2550: 2546: 2542: 2538: 2537: 2533: 2531: 2527: 2523: 2519: 2515: 2511: 2507: 2503: 2499: 2498: 2494: 2491: 2487: 2483: 2479: 2475: 2471: 2467: 2463: 2459: 2455: 2451: 2447: 2443: 2439: 2435: 2434: 2430: 2429: 2427: 2423: 2419: 2415: 2412: 2411: 2409: 2405: 2402: 2399: 2398:Easter Island 2395: 2391: 2387: 2383: 2379: 2375: 2371: 2367: 2363: 2360: 2359: 2358: 2355: 2354: 2348: 2345: 2343: 2339: 2335: 2331: 2327: 2323: 2313: 2311: 2310:Sephardi Jews 2307: 2302: 2300: 2296: 2292: 2288: 2284: 2280: 2276: 2272: 2268: 2264: 2255: 2253: 2249: 2245: 2241: 2237: 2233: 2229: 2225: 2221: 2217: 2213: 2209: 2199: 2197: 2193: 2189: 2185: 2181: 2177: 2173: 2169: 2168:Faroe Islands 2165: 2161: 2156: 2154: 2150: 2145: 2141: 2131: 2129: 2125: 2121: 2117: 2113: 2108: 2106: 2102: 2098: 2094: 2090: 2086: 2082: 2078: 2074: 2070: 2066: 2062: 2058: 2054: 2050: 2040: 2032: 2030: 2025: 2023: 2019: 2015: 2011: 2006: 2004: 2000: 1996: 1992: 1987: 1985: 1981: 1977: 1976:Western India 1973: 1968: 1966: 1961: 1960:Indian people 1956: 1954: 1950: 1940: 1938: 1934: 1930: 1926: 1921: 1919: 1915: 1910: 1908: 1904: 1900: 1895: 1893: 1889: 1885: 1880: 1878: 1874: 1870: 1866: 1862: 1858: 1854: 1850: 1846: 1842: 1838: 1834: 1828: 1826: 1822: 1813: 1811: 1807: 1803: 1799: 1795: 1791: 1787: 1782: 1780: 1776: 1772: 1768: 1764: 1760: 1756: 1752: 1748: 1744: 1740: 1736: 1732: 1728: 1723: 1718: 1714: 1710: 1706: 1702: 1697: 1695: 1694:Kyrgyz people 1691: 1687: 1683: 1679: 1678:Kazakh tribes 1675: 1670: 1668: 1658: 1656: 1652: 1648: 1644: 1640: 1635: 1633: 1629: 1625: 1621: 1617: 1613: 1609: 1605: 1600: 1598: 1594: 1590: 1586: 1576: 1574: 1570: 1565: 1563: 1559: 1555: 1551: 1547: 1543: 1539: 1534: 1532: 1528: 1523: 1521: 1516: 1513: 1509: 1506:) to 3~4% in 1505: 1501: 1498:), and upper 1497: 1493: 1492:central China 1489: 1485: 1481: 1477: 1473: 1469: 1465: 1461: 1460:Qin Mountains 1457: 1453: 1449: 1444: 1442: 1438: 1434: 1424: 1422: 1418: 1414: 1410: 1406: 1403:in Chukotka ( 1402: 1399:and 39.2% of 1398: 1394: 1390: 1385: 1384:, and so on. 1383: 1379: 1375: 1371: 1367: 1363: 1360: 1356: 1352: 1348: 1344: 1340: 1336: 1332: 1327: 1325: 1321: 1316: 1314: 1310: 1306: 1302: 1298: 1294: 1290: 1286: 1283: 1279: 1275: 1271: 1267: 1263: 1253: 1251: 1247: 1243: 1239: 1235: 1231: 1227: 1223: 1219: 1215: 1211: 1207: 1203: 1199: 1195: 1191: 1187: 1183: 1179: 1175: 1171: 1167: 1163: 1159: 1155: 1151: 1147: 1143: 1139: 1126: 1122: 1119: 1115: 1112: 1108: 1105: 1101: 1098: 1094: 1091: 1087: 1084: 1080: 1077: 1073: 1070: 1066: 1062: 1059: 1055: 1053: 1049: 1046: 1042: 1039: 1035: 1034: 1033: 1030: 1028: 1027:South America 1024: 1020: 1006: 1003: 1002: 995: 991: 988: 985: 984: 980: 977: 974: 973: 969: 966: 963: 962: 958: 955: 952: 951: 947: 944: 941: 940: 936: 933: 930: 929: 926: 923: 921: 917: 913: 909: 905: 901: 897: 892: 890: 886: 882: 878: 874: 870: 866: 859:North America 856: 852: 850: 846: 842: 838: 834: 830: 826: 825:Bering Strait 822: 818: 814: 813:pre-Columbian 808: 804: 789: 787: 782: 781:arylsulfatase 761: 760: 756: 755: 753: 752: 748: 741: 740: 736: 735: 733: 732: 728: 723: 722: 718: 715: 714: 710: 709: 708: 707: 705: 704: 700: 699: 697: 694: 693: 691: 688: 687: 686: 685: 681: 680: 679: 677: 656: 653: 652: 650: 647: 643: 640: 638: 635: 632: 629: 626: 623: 620: 617: 616: 615:, L472, L528 614: 611: 610: 608: 607: 605: 602: 601: 600: 599: 595: 594: 593: 591: 572: 571: 567: 561:L245 (Q1b1a1) 560: 559: 555: 554: 552: 551: 547: 546: 544: 543: 539: 538: 536: 535: 531: 522: 521: 517: 516: 514: 513: 509: 506: 505: 501: 494: 493: 489: 486: 485: 481: 476: 475: 471: 466: 465: 461: 460: 458: 457: 453: 452: 450: 449: 445: 444: 443:L54 (Q1a2a1) 442: 441: 437: 436: 434: 433: 429: 428: 426: 425: 421: 415:L712 (Q1a1b1) 414: 413: 409: 408: 406: 405: 401: 396: 395: 391: 390: 388: 387: 383: 382: 380: 377: 376: 374: 371: 370: 368: 365: 364: 362: 359: 358: 357: 354: 344: 342: 338: 334: 330: 326: 316: 313: 312:phylogenetics 309: 305: 301: 285: 279: 276: 273: 270: 269: 268: 260: 258: 254: 250: 245: 243: 239: 235: 226: 224: 220: 216: 211: 209: 208:Haplogroup Q1 205: 201: 197: 193: 185: 181: 177: 173: 169: 165: 161: 157: 153: 149: 145: 141: 137: 133: 129: 125: 121: 117: 113: 110: 106: 102: 98: 94: 91: 87: 84: 81: 77: 74: 70: 67: 63: 59: 55: 48: 43: 38: 33: 19: 11086: 11060:. Retrieved 11045: 11032:. Retrieved 11009: 10981: 10977: 10938: 10934: 10897: 10893: 10851: 10847: 10802: 10798: 10775: 10742: 10738: 10692: 10688: 10649: 10645: 10608: 10604: 10561: 10557: 10520: 10516: 10472: 10468: 10433: 10429: 10401:(1): 47–58. 10398: 10394: 10355: 10351: 10315:(1): 121–6. 10312: 10308: 10271: 10267: 10239: 10235: 10205: 10201: 10162: 10158: 10121: 10117: 10079: 10076:BMC Genetics 10075: 10063:Bibliography 10026: 10022: 10012: 10003: 9994: 9985: 9952: 9948: 9941: 9915: 9905: 9862: 9858: 9847: 9812: 9808: 9798: 9755: 9751: 9741: 9722: 9710: 9705: 9678: 9674: 9664: 9630: 9626: 9619: 9608:. Retrieved 9604:the original 9599: 9590: 9555: 9551: 9541: 9533: 9529: 9524: 9487: 9483: 9473: 9428: 9424: 9414: 9369: 9365: 9315: 9311: 9301: 9277:(8): 583–8. 9274: 9270: 9260: 9215: 9211: 9200: 9167: 9163: 9157: 9112: 9108: 9098: 9089: 9054: 9050: 9040: 9007: 9003: 8997: 8951: 8947: 8937: 8905:(1): 91–99. 8902: 8898: 8888: 8879: 8875: 8852: 8838: 8824: 8810: 8799: 8790: 8776: 8745: 8734: 8723: 8690: 8686: 8680: 8635: 8631: 8621: 8576: 8572: 8562: 8548: 8534: 8499: 8495: 8485: 8471: 8438: 8434: 8428: 8403: 8399: 8393: 8348: 8344: 8334: 8289: 8285: 8275: 8230: 8226: 8216: 8181: 8177: 8123: 8119: 8109: 8097:. Retrieved 8082: 8075: 8042: 8038: 7994: 7990: 7980: 7943: 7940:BMC Genetics 7939: 7897: 7893: 7835: 7831: 7821: 7811: 7766: 7762: 7714: 7710: 7656: 7652: 7594: 7590: 7579: 7534: 7530: 7519: 7484: 7480: 7470: 7440:(1): 48–54. 7437: 7433: 7427: 7417: 7382: 7378: 7318: 7314: 7283: 7279: 7273: 7238: 7234: 7224: 7213: 7209: 7156: 7152: 7096: 7092: 7063: 7059: 7053: 7008: 7004: 6956: 6952: 6892: 6888: 6835: 6831: 6821: 6813: 6809: 6804: 6794: 6761: 6757: 6751: 6721:(6): 653–7. 6718: 6714: 6708: 6681: 6677: 6667: 6643:(1): 47–58. 6640: 6636: 6589:(5): 743–4. 6586: 6582: 6576: 6559: 6555: 6534: 6489: 6485: 6475: 6442: 6438: 6428: 6397: 6393: 6380: 6353: 6349: 6339: 6304: 6300: 6290: 6263: 6259: 6249: 6214: 6210: 6200: 6191: 6187: 6181: 6172: 6163: 6158:Anthropology 6153: 6120: 6116: 6110: 6101: 6095: 6068: 6064: 6012: 6008: 5998: 5953: 5949: 5915:. Retrieved 5911:the original 5859: 5856:BMC Genetics 5855: 5809: 5805: 5755: 5751: 5701: 5697: 5645: 5641: 5582: 5578: 5543:(1): 47–58. 5540: 5536: 5490: 5486: 5439: 5435: 5372: 5368: 5358: 5339: 5335: 5325: 5308: 5304: 5298: 5258:(1): 65–76. 5255: 5251: 5245: 5219: 5215: 5209: 5186:(1): 13–20. 5183: 5179: 5173: 5128: 5124: 5114: 5089: 5085: 5079: 5052: 5048: 5038: 5021: 5017: 5011: 4966: 4962: 4897: 4894:BMC Genomics 4893: 4883: 4850: 4846: 4840: 4822: 4800:(1): 45–55. 4797: 4793: 4741: 4737: 4713:. Retrieved 4709:the original 4699: 4664: 4660: 4650: 4633: 4626: 4616: 4584:(5): 830–8. 4581: 4577: 4567: 4559:the original 4544: 4526: 4483: 4479: 4469: 4458:. Retrieved 4454: 4444: 4385: 4381: 4333: 4329: 4283: 4279: 4252: 4244: 4240: 4236: 4232: 4228: 4193: 4189: 4139: 4135: 4085: 4081: 4011: 4007: 3971: 3965:. Retrieved 3935: 3931: 3917: 3872: 3868: 3857: 3831: 3822: 3812: 3805: 3800: 3794: 3785: 3776: 3767: 3750: 3741: 3732: 3723: 3714: 3705: 3699: 3666: 3662: 3656: 3647: 3616: 3512: 3455: 3155: 3147: 2936:Genghis Khan 2889:Yuan dynasty 2812:Jiang County 2808:Western Zhou 2651: 2643: 2627: 2594: 2588: 2582: 2557:Saudi Arabia 2534: 2495: 2492:populations. 2431: 2422:Paleo-Eskimo 2413: 2403: 2361: 2356: 2346: 2322:North Africa 2319: 2303: 2261: 2205: 2166:, 3% in the 2157: 2137: 2109: 2097:Transylvania 2047:In Central- 2046: 2038: 2026: 2007: 1988: 1969: 1957: 1946: 1933:Afshar tribe 1922: 1911: 1899:Saudi Arabia 1896: 1881: 1867:and 4.8% of 1829: 1819: 1806:Turkmenistan 1783: 1762: 1754: 1750: 1747:Turkmenistan 1738: 1731:Turkmenistan 1721: 1716: 1708: 1698: 1690:Kangar union 1671: 1667:Central Asia 1664: 1661:Central Asia 1636: 1619: 1601: 1582: 1566: 1535: 1530: 1524: 1517: 1511: 1445: 1440: 1430: 1413:Kolyma River 1386: 1328: 1317: 1305:Tozhu Tuvans 1295:and west of 1287: 1259: 1246:Turkmenistan 1242:Saudi Arabia 1178:Altai people 1135: 1127:, and so on. 1031: 1016: 1004: 998: 924: 893: 862: 853: 810: 792:Distribution 788:to Q-ss4bp. 778: 757: 749: 737: 729: 719: 711: 701: 695: 689: 682: 673: 657:, L214, L215 603: 596: 587: 568: 556: 548: 540: 532: 518: 510: 502: 490: 482: 472: 462: 454: 446: 438: 435:L53 (Q1a2a) 430: 422: 410: 402: 392: 384: 378: 372: 366: 360: 350: 322: 300:Y chromosome 297: 266: 246: 238:P-P226 (M45) 232: 219:Central Asia 212: 195: 192:Haplogroup Q 191: 190: 69:Central Asia 40:Haplogroup Q 8496:Croat Med J 5273:11336/14301 2994:Akha people 2952:Populations 2907:Kublai Khan 2849:Heigouliang 2733:Krasnoyarsk 2549:Afghanistan 2518:Afghanistan 2484:, Bruneian 2438:Han Chinese 2374:Afghanistan 2338:East Africa 2244:Scandinavia 2232:Rhône-Alpes 2224:Switzerland 2057:Belarusians 2029:Sri Lankans 1937:Oghuz Turks 1888:Marsh Arabs 1877:Oghuz Turks 1871:), 4.5% in 1859:), 4.9% in 1855:(Luristan, 1847:), 6.8% in 1775:Afghanistan 1707:). Karafet 1608:Kinh people 1593:Philippines 1480:north China 1374:Khakassians 1297:Lake Baikal 1270:Lake Baikal 1230:Afghanistan 1076:El Salvador 1023:Mesoamerica 375:MEH2 (Q1a) 170:) 38%, the 95:(L232/S432) 89:Descendants 11108:Categories 11029:2003066679 10695:(1): 232. 9610:2009-11-21 8292:(1): 154. 8039:Hum. Genet 7838:(1): 288. 7114:1808/13586 5917:2010-07-17 4900:(1): 131. 4715:2010-01-30 4460:2024-01-21 4088:(1): 232. 3967:2009-11-19 3875:(S1): 18. 3850:References 2969:Ket people 2792:Qilakitsoq 2784:Greenland 2762:Washington 2750:, western 2553:Kyrgyzstan 2446:Vietnamese 2342:Madagascar 2293:, 3.6% in 2252:Azerbaijan 2194:, 0.5% in 2190:, 1.1% in 2186:, 4.6% in 2176:Icelanders 2116:Azerbaijan 2089:Bulgarians 2083:, 0.8% of 2077:Hungarians 2071:, 1.5% of 2061:Ukrainians 2059:, 1.3% of 2055:, 1.5% of 2003:Bangladesh 1943:South Asia 1705:Tajikistan 1643:Ayeyarwady 1500:east China 1456:Huai River 1393:Amur River 1256:North Asia 1250:Uzbekistan 1118:Costa Rica 931:Ethnicity 916:Sermersooq 621:, N14/M265 448:Q-CTS11969 306:(SNPs) or 234:Haplogroup 150:) 62.5%., 10490:10130/491 10082:(1): 59. 9004:Hum Genet 7946:(1): 59. 7093:Hum. Biol 6910:10130/491 6117:Hum Genet 5758:(1): 10. 4500:0002-9297 3813:PhyloTree 3648:Footnotes 3014:Paragroup 2810:period), 2796:Greenland 2478:Bhutanese 2474:Hmong Daw 2380:males (3 2326:Egyptians 2192:Lithuania 2128:Armenians 2124:Georgians 2085:Moldovans 2081:Romanians 2014:Kathmandu 1980:New Delhi 1909:peoples. 1892:Sumerians 1865:Assyrians 1863:(5.1% of 1589:Indonesia 1562:Taiwanese 1448:East Asia 1427:East Asia 1417:Kamchatka 1409:Yukaghirs 1210:Indonesia 1184:, etc.), 1170:Yukaghirs 1123:3.95% in 1111:Argentina 1097:Nicaragua 1088:16.1% in 1056:37.6% in 1045:Guatemala 953:Hispanic 912:Greenland 900:Greenland 724:M25, M143 550:Q-FGC1774 484:Q-CTS1780 353:subclades 294:Subclades 251:area (or 182:and some 11000:14595095 10965:18374297 10922:36788262 10914:11153912 10876:15372031 10839:11526236 10759:15300852 10729:18021436 10676:16400607 10625:16770078 10596:20148029 10545:31651899 10537:16845541 10499:17274803 10460:19259129 10417:16328082 10382:17436243 10339:17047675 10296:10763736 10288:14586639 10258:17928816 10224:17928816 10189:12900798 10146:10310338 10138:14740294 10108:19772609 10053:25487330 9977:20553478 9969:25130911 9897:26087396 9831:24522593 9790:24522598 9697:20837606 9647:15300852 9582:18374297 9516:25468874 9465:21904623 9425:PLOS ONE 9406:24204668 9366:PLOS ONE 9334:24132124 9293:21677663 9252:22815981 9212:PLOS ONE 9192:33311525 9184:17506287 9164:Hum Biol 9149:22470552 9109:PLOS ONE 9081:19061982 9032:10310338 9024:14740294 8988:23251386 8948:PLOS ONE 8929:18685561 8882:: 35–85. 8715:13217908 8707:18373723 8672:23483890 8632:PLOS ONE 8613:23341985 8573:PLOS ONE 8526:21674832 8455:16161635 8435:Genetika 8420:28165493 8385:24130682 8345:PLOS ONE 8326:19573232 8267:24614885 8227:PLOS ONE 8208:16400607 8150:17047675 8067:10763736 8059:14586639 8021:18374297 7972:19772609 7916:17928816 7872:21970613 7803:23431392 7763:PLOS ONE 7731:16770078 7693:22815981 7653:PLOS ONE 7631:24204668 7591:PLOS ONE 7571:22470552 7531:PLOS ONE 7511:11481588 7454:23198991 7409:12929085 7355:11526236 7265:24281365 7193:22586471 7153:PLOS ONE 7123:16114819 7045:25090432 7005:PLOS ONE 6983:27111036 6919:17274803 6862:16489223 6832:Genetics 6786:27644576 6778:22569803 6743:27125545 6735:20714743 6700:23682168 6659:16328082 6611:23248209 6603:24398978 6526:25938511 6486:PLOS ONE 6467:20553478 6459:25130911 6420:Archived 6416:20837606 6372:20837606 6331:21505448 6282:30408262 6241:19259129 6145:23011845 6137:16261343 6102:Genetika 6087:21677663 6039:22281367 5990:24204668 5950:PLOS ONE 5888:24965575 5828:20207712 5784:21463511 5728:17436243 5670:36788262 5662:11153912 5607:15372031 5559:16328082 5515:31651899 5507:16845541 5466:11731934 5409:22808085 5369:PLOS ONE 5282:20059473 5236:22770600 5200:20734436 5165:26636572 5125:PLOS ONE 5106:16916590 5071:22832385 5003:23990949 4963:PLOS ONE 4926:25887241 4867:24878616 4830:Archived 4814:16337103 4776:20148029 4691:18618732 4608:18385274 4534:Archived 4518:12929085 4422:25635810 4382:PLOS ONE 4360:39635944 4352:19689942 4300:17633562 4280:Genetika 4220:12900798 4156:12617488 4114:18021436 4030:14595095 3962:18313026 3909:28251872 3810:, and; 3801:op. cit. 3691:23291764 3683:24166809 3321:F-Y27277 2999:Turkmens 2947:See also 2923:Göktürks 2842:Xinjiang 2744:Anzick-1 2670:and the 2611:and the 2569:Mongolia 2541:Pakistan 2526:Mongolia 2502:Turkmens 2490:Peruvian 2470:Tibetans 2466:Mongolia 2450:Japanese 2396:male of 2370:Pakistan 2357:Q (M242) 2330:Algerian 2236:Shetland 2149:Götaland 2112:Caucasus 2093:Székelys 2063:1.3% of 2053:Russians 2027:3.3% of 2008:1.2% of 1949:Pakistan 1935:(one of 1918:Lebanese 1853:Lorestan 1849:Khorasan 1837:Golestan 1833:Turkmens 1798:Turkmens 1790:Pashtuns 1771:Turkmens 1759:Golestan 1743:Turkmens 1737:. Wells 1686:Kankalis 1655:Thailand 1597:Thailand 1554:Shizuoka 1550:Japanese 1504:Shandong 1468:Xinjiang 1433:Mongolia 1370:E. Vajda 1309:Xinjiang 1282:Altaians 1278:Tubalars 1274:Chelkans 1226:Pakistan 1218:Thailand 1186:Mongolia 1090:Colombia 1071:segment) 922:at 30%. 797:Americas 204:subclade 154:60.0%., 152:Chelkans 148:Xinjiang 142:63.6%., 140:Altaians 138:66.4%., 130:(mainly 124:Turkmens 79:Ancestor 11081:, from 11062:May 13, 11034:May 13, 10956:2427286 10884:4301581 10856:Bibcode 10807:Bibcode 10767:1571356 10720:2258157 10697:Bibcode 10667:1380230 10633:7017701 10587:3951495 10566:Bibcode 10507:1041367 10451:2986641 10373:1852741 10330:2588664 10180:1180678 10099:2759955 10044:4275886 9888:4878456 9867:Bibcode 9839:4445278 9781:4878442 9760:Bibcode 9655:1571356 9573:2427286 9507:4327154 9456:3164178 9433:Bibcode 9397:3799995 9374:Bibcode 9243:3399854 9220:Bibcode 9140:3314501 9117:Bibcode 9072:2668061 8979:3519480 8956:Bibcode 8920:2985948 8663:3590186 8640:Bibcode 8604:3547065 8581:Bibcode 8517:3131682 8463:1357824 8376:3794028 8353:Bibcode 8317:2720951 8294:Bibcode 8258:3948632 8235:Bibcode 8199:1380230 8141:2588664 8099:May 13, 8012:2427286 7963:2759955 7863:3215667 7840:Bibcode 7794:3576335 7771:Bibcode 7739:7017701 7684:3399854 7661:Bibcode 7622:3799995 7599:Bibcode 7562:3314501 7539:Bibcode 7502:1235490 7462:2752490 7400:1180698 7323:Bibcode 7256:4350590 7184:3346718 7161:Bibcode 7131:7953854 7036:4121179 7013:Bibcode 6974:4884158 6927:1041367 6853:1456369 6517:4418768 6494:Bibcode 6322:3179364 6232:2986641 6030:3276666 5981:3799995 5958:Bibcode 5879:4083334 5775:3087676 5719:1852741 5615:4301581 5587:Bibcode 5400:3393733 5377:Bibcode 5290:5908692 5156:4670172 5133:Bibcode 4994:3749222 4971:Bibcode 4917:4422311 4875:2906322 4767:3951495 4746:Bibcode 4682:2584155 4599:2336805 4509:1180698 4413:4312058 4390:Bibcode 4211:1180678 4164:9443804 4105:2258157 3953:2427228 3900:5333174 3877:Bibcode 3525:K-M2313 3518: 3459: 3444: 3430: 3414: 3405: 3396: 3218: 3201: 3148:updated 3071:Q-P89.1 3031:Q-NWT01 2865:Xiongnu 2853:Xiongnu 2835:Ningxia 2752:Montana 2682:. Some 2672:Uyghurs 2664:Mongols 2660:Sindhis 2656:Hazaras 2522:Lebanon 2514:Jawzjan 2462:Mongols 2458:Koreans 2454:Kalmyks 2442:Dungans 2418:Koryaks 2404:Q-P36.2 2394:Rapanui 2386:Laghman 2378:Pashtun 2334:Comoros 2295:Sciacca 2275:Korčula 2267:Croatia 2240:Vikings 2212:Germany 2196:Estonia 2184:Finland 2180:Iceland 2172:Vikings 2164:Denmark 2153:Gotland 2144:Swedish 2073:Slovaks 1999:Tripura 1993:13/89, 1972:Gujarat 1914:Syrians 1841:Isfahan 1786:Afghans 1767:Jawzjan 1674:Kazakhs 1639:Myanmar 1604:Vietnam 1558:Saitama 1538:Koreans 1520:Uyghurs 1476:Shaanxi 1437:Mongols 1421:Koryaks 1378:Kalmyks 1335:Selkups 1262:Siberia 1214:Vietnam 1194:Uyghurs 1182:Koryaks 1154:Selkups 1146:Siberia 1069:Mestizo 1058:Ecuador 1043:51% in 1038:Bolivia 1036:61% in 920:Qeqqata 904:Koryaks 849:Q-NWT01 845:Q-P89.1 739:Q-P89.1 696:Q-P36.2 570:Q-Y1150 512:Q-F1161 386:Q-NWT01 379:Q-F1096 367:Q-P36.2 333:Houston 229:Origins 160:Tubalar 136:Selkups 134:) 73%, 114:93.8%, 11053: 11027: 11017: 10998: 10963: 10953: 10920: 10912: 10882: 10874: 10848:Nature 10837: 10827: 10782: 10765: 10757: 10727: 10717: 10674: 10664: 10631: 10623: 10594: 10584: 10558:Nature 10543: 10535: 10505: 10497: 10458: 10448: 10415: 10380: 10370: 10337: 10327: 10294: 10286: 10256: 10222: 10187: 10177: 10144: 10136: 10106: 10096: 10051: 10041: 9975: 9967: 9895: 9885: 9859:Nature 9837: 9829: 9809:Nature 9788: 9778: 9752:Nature 9695: 9653: 9645: 9580: 9570: 9530:et al. 9514: 9504: 9463: 9453: 9404: 9394: 9332: 9291: 9250: 9240: 9190: 9182: 9147: 9137: 9079: 9069: 9030: 9022: 8986: 8976: 8927: 8917: 8713: 8705: 8670: 8660: 8611: 8601: 8524: 8514: 8461: 8453: 8418: 8383: 8373: 8324: 8314: 8265: 8255: 8206: 8196: 8148: 8138: 8090: 8065: 8057: 8019: 8009: 7970: 7960: 7914: 7870: 7860: 7801: 7791: 7737: 7729: 7691: 7681: 7629: 7619: 7569: 7559: 7509: 7499: 7460: 7452: 7407: 7397: 7353: 7343: 7263: 7253: 7210:et al. 7191: 7181: 7129: 7121: 7043: 7033: 6981: 6971: 6925: 6917: 6860: 6850: 6810:et al. 6784: 6776: 6741: 6733: 6698: 6657: 6609: 6601: 6524: 6514: 6465: 6457: 6414: 6370: 6329: 6319: 6280: 6239: 6229: 6143: 6135: 6085: 6037: 6027: 5988: 5978: 5886: 5876: 5862:: 77. 5826: 5782: 5772: 5726: 5716: 5668: 5660: 5613: 5605: 5579:Nature 5557: 5513: 5505: 5464: 5457:384887 5454: 5415:Brazil 5407: 5397: 5288: 5280: 5234: 5198: 5163: 5153: 5104: 5069: 5001: 4991: 4924: 4914: 4873: 4865: 4812: 4774: 4764: 4738:Nature 4689: 4679: 4642:DYS435 4606: 4596: 4516: 4506: 4498: 4420: 4410: 4358: 4350: 4308:566825 4306: 4298: 4218: 4208: 4162: 4154: 4112: 4102: 4028: 3960: 3950: 3907: 3897: 3760:K-M526 3689: 3681: 3548: 3544: 3539: 3527: 3508: 3335: 3327: 3323: 3318: 3081:Q-L275 3076:Q-Z780 3066:Q-M323 3046:Q-M346 3036:Q-M120 3027:Q-M242 2919:Shatuo 2915:Korguz 2903:Korguz 2872:Barkol 2816:Shanxi 2803:China 2788:Saqqaq 2777:Kurgan 2731:Bank, 2694:) and 2692:Panama 2666:, the 2652:Q-M378 2645:Q-L275 2629:Q-M323 2609:Ticuna 2575:, and 2559:, the 2536:Q-M346 2530:Turkey 2528:, and 2488:, and 2482:Hazara 2472:, and 2433:Q-M120 2414:Q-MEH2 2390:Kapisa 2316:Africa 2291:Ragusa 2283:Sicily 2248:Azeris 2216:France 2188:Latvia 2160:Norway 2101:Attila 2069:Czechs 2035:Europe 1997:4/60, 1991:Chakma 1925:Turkey 1884:Iraqis 1869:Azeris 1810:Uzbeks 1794:Tajiks 1763:et al. 1755:et al. 1751:et al. 1739:et al. 1722:et al. 1717:et al. 1713:Uzbeks 1709:et al. 1701:Tajiks 1682:Qangly 1620:et al. 1512:et al. 1484:Shanxi 1441:et al. 1389:Nivkhs 1382:Khanty 1322:, the 1301:Tuvans 1174:Tuvans 1162:Nivkhs 1142:Russia 1125:Brazil 1116:5% in 1083:Panama 1065:Mexico 975:Asian 967:12.6% 964:Black 956:16.3% 945:63.7% 942:White 896:Saqqaq 877:Eskimo 873:Apache 869:Navajo 839:, and 837:Q-Z780 829:Q-M346 759:Q-M378 751:Q-L275 731:Q-M346 713:Q-M120 703:Q-MEH2 698:P36.2 690:Q-M242 604:Q-M242 542:Q-M378 534:Q-L275 520:Q-L527 515:F1161 504:Q-F835 492:Q-L330 474:Q-L804 424:Q-M346 412:Q-L712 394:Q-M120 373:Q-MEH2 361:Q-M242 339:. The 242:R-M207 196:Q-M242 146:(from 144:Tuvans 83:P1-M45 10918:S2CID 10880:S2CID 10830:56946 10763:S2CID 10629:S2CID 10541:S2CID 10503:S2CID 10292:S2CID 10142:S2CID 9973:S2CID 9835:S2CID 9651:S2CID 9188:S2CID 9028:S2CID 8711:S2CID 8459:S2CID 8416:S2CID 8063:S2CID 7735:S2CID 7458:S2CID 7346:56946 7127:S2CID 6923:S2CID 6885:(PDF) 6799:1.9%. 6782:S2CID 6739:S2CID 6607:S2CID 6463:S2CID 6390:(PDF) 6141:S2CID 5666:S2CID 5611:S2CID 5511:S2CID 5286:S2CID 4871:S2CID 4356:S2CID 4304:S2CID 4160:S2CID 3928:(PDF) 3687:S2CID 3337:GHIJK 3056:Q-L54 3051:Q-L53 3041:Q-M25 2984:Inuit 2911:Ongud 2901:(cf) 2896:China 2893:Hebei 2770:Altai 2676:China 2613:Wayuu 2583:Q-L53 2573:Tibet 2565:India 2497:Q-M25 2486:Murut 2382:Kabul 2366:India 2279:Italy 2095:from 2065:Poles 2022:Tibet 2018:Nepal 1995:Marma 1984:India 1929:Turks 1745:from 1632:Hanoi 1616:Hanoi 1610:from 1573:Japan 1569:China 1542:Seoul 1527:Tibet 1496:Henan 1488:Hebei 1472:Gansu 1452:China 1339:Altai 1266:Altai 1222:India 1206:Japan 1202:Korea 1198:Tibet 1190:China 1104:Chile 989:0.9% 978:4.8% 889:Aleut 885:Yupik 881:Inuit 833:Q-L54 754:L275 742:P89.1 721:Q-M25 706:MEH2 692:M242 684:P-M45 642:NWT01 637:P89.1 606:M242 598:P-M45 558:Q-245 464:Q-M19 440:Q-L54 432:Q-L53 404:Q-M25 363:M242 337:Texas 198:is a 162:41%, 158:54%, 132:Yomut 126:from 122:80%, 120:Inuit 118:92%, 11064:2014 11051:ISBN 11036:2014 11025:LCCN 11015:ISBN 10996:PMID 10961:PMID 10910:PMID 10872:PMID 10835:PMID 10780:ISBN 10755:PMID 10725:PMID 10672:PMID 10621:PMID 10592:PMID 10533:PMID 10495:PMID 10456:PMID 10413:PMID 10378:PMID 10335:PMID 10284:PMID 10254:PMID 10220:PMID 10185:PMID 10134:PMID 10104:PMID 10049:PMID 10027:B370 9965:PMID 9910:2014 9893:PMID 9827:PMID 9786:PMID 9693:PMID 9643:PMID 9578:PMID 9512:PMID 9461:PMID 9402:PMID 9330:PMID 9289:PMID 9248:PMID 9180:PMID 9145:PMID 9077:PMID 9020:PMID 8984:PMID 8925:PMID 8703:PMID 8668:PMID 8609:PMID 8522:PMID 8451:PMID 8381:PMID 8322:PMID 8263:PMID 8204:PMID 8146:PMID 8101:2014 8088:ISBN 8055:PMID 8017:PMID 7968:PMID 7912:PMID 7868:PMID 7799:PMID 7727:PMID 7689:PMID 7627:PMID 7567:PMID 7507:PMID 7450:PMID 7405:PMID 7351:PMID 7286:: 1. 7261:PMID 7189:PMID 7119:PMID 7041:PMID 6979:PMID 6915:PMID 6858:PMID 6774:PMID 6731:PMID 6696:PMID 6655:PMID 6599:PMID 6522:PMID 6455:PMID 6412:PMID 6368:PMID 6327:PMID 6278:PMID 6237:PMID 6133:PMID 6083:PMID 6035:PMID 5986:PMID 5884:PMID 5824:PMID 5780:PMID 5724:PMID 5658:PMID 5603:PMID 5555:PMID 5503:PMID 5462:PMID 5405:PMID 5278:PMID 5232:PMID 5196:PMID 5161:PMID 5102:PMID 5067:PMID 4999:PMID 4922:PMID 4863:PMID 4810:PMID 4772:PMID 4687:PMID 4604:PMID 4514:PMID 4496:ISSN 4418:PMID 4348:PMID 4296:PMID 4216:PMID 4152:PMID 4110:PMID 4026:PMID 3958:PMID 3905:PMID 3679:PMID 3506:K2b1 3351:HIJK 3243:A1b1 3199:A0-T 3061:Q-M3 2880:Huns 2857:Hami 2822:1 O* 2658:and 2590:Q-M3 2577:Bali 2545:Iran 2510:Iran 2408:Iran 2388:, 1 2384:, 4 2368:and 2340:and 2271:Hvar 2228:Lyon 2126:and 2110:The 2105:Huns 1907:Oman 1873:Fars 1857:Lurs 1825:Iran 1779:Iran 1777:and 1651:Akha 1647:Bago 1624:Kinh 1556:and 1544:and 1341:and 1331:Kets 1289:Tuva 1268:and 1238:Iraq 1234:Iran 1150:Kets 1138:Asia 1132:Asia 1052:Peru 1025:and 981:~0% 906:and 841:Q-M3 805:and 655:M378 649:L275 631:M346 619:M120 613:MEH2 523:L527 456:Q-M3 351:The 257:SNPs 221:and 112:Kets 10986:doi 10951:PMC 10943:doi 10902:doi 10898:107 10864:doi 10852:431 10825:PMC 10815:doi 10747:doi 10715:PMC 10705:doi 10662:PMC 10654:doi 10613:doi 10582:PMC 10574:doi 10562:463 10525:doi 10521:120 10485:hdl 10477:doi 10446:PMC 10438:doi 10403:doi 10368:PMC 10360:doi 10325:PMC 10317:doi 10276:doi 10272:114 10244:doi 10210:doi 10175:PMC 10167:doi 10126:doi 10122:114 10094:PMC 10084:doi 10039:PMC 10031:doi 9957:doi 9883:PMC 9875:doi 9863:523 9817:doi 9813:506 9776:PMC 9768:doi 9756:506 9683:doi 9635:doi 9568:PMC 9560:doi 9502:PMC 9492:doi 9451:PMC 9441:doi 9392:PMC 9382:doi 9320:doi 9279:doi 9238:PMC 9228:doi 9172:doi 9135:PMC 9125:doi 9067:PMC 9059:doi 9012:doi 9008:114 8974:PMC 8964:doi 8915:PMC 8907:doi 8695:doi 8658:PMC 8648:doi 8599:PMC 8589:doi 8512:PMC 8504:doi 8443:doi 8408:doi 8371:PMC 8361:doi 8312:PMC 8302:doi 8253:PMC 8243:doi 8194:PMC 8186:doi 8136:PMC 8128:doi 8047:doi 8043:114 8007:PMC 7999:doi 7958:PMC 7948:doi 7902:doi 7858:PMC 7848:doi 7789:PMC 7779:doi 7719:doi 7679:PMC 7669:doi 7617:PMC 7607:doi 7557:PMC 7547:doi 7497:PMC 7489:doi 7442:doi 7395:PMC 7387:doi 7341:PMC 7331:doi 7251:PMC 7243:doi 7179:PMC 7169:doi 7109:hdl 7101:doi 7068:doi 7031:PMC 7021:doi 6969:PMC 6961:doi 6905:hdl 6897:doi 6848:PMC 6840:doi 6836:172 6766:doi 6762:126 6723:doi 6719:124 6686:doi 6645:doi 6591:doi 6587:128 6564:doi 6512:PMC 6502:doi 6447:doi 6402:doi 6358:doi 6317:PMC 6309:doi 6268:doi 6227:PMC 6219:doi 6125:doi 6121:118 6073:doi 6025:PMC 6017:doi 5976:PMC 5966:doi 5874:PMC 5864:doi 5814:doi 5770:PMC 5760:doi 5714:PMC 5706:doi 5650:doi 5646:107 5595:doi 5583:431 5545:doi 5495:doi 5491:120 5452:PMC 5444:doi 5395:PMC 5385:doi 5344:doi 5313:doi 5268:hdl 5260:doi 5224:doi 5188:doi 5184:143 5151:PMC 5141:doi 5094:doi 5090:171 5057:doi 5026:doi 4989:PMC 4979:doi 4912:PMC 4902:doi 4855:doi 4851:129 4802:doi 4798:164 4762:PMC 4754:doi 4742:463 4677:PMC 4669:doi 4665:137 4639:STR 4594:PMC 4586:doi 4504:PMC 4488:doi 4408:PMC 4398:doi 4338:doi 4288:doi 4206:PMC 4198:doi 4144:doi 4100:PMC 4090:doi 4016:doi 3948:PMC 3940:doi 3895:PMC 3885:doi 3671:doi 3589:P1a 3584:P1b 3579:P1c 3567:NO1 3495:K2a 3487:K2b 3480:K2c 3473:K2d 3466:K2e 3360:IJK 3233:A1b 3227:A1a 3193:A00 2794:), 2512:), 2504:of 2464:in 2254:). 2206:In 2158:In 2138:In 2103:'s 2012:in 1947:In 1835:of 1800:of 1773:of 1665:In 1490:), 1478:), 1318:In 1260:In 1021:of 625:M25 298:In 194:or 11110:: 11085:, 11023:. 10994:. 10982:21 10980:. 10976:. 10959:. 10949:. 10939:82 10937:. 10933:. 10916:. 10908:. 10896:. 10878:. 10870:. 10862:. 10850:. 10833:. 10823:. 10813:. 10803:98 10801:. 10797:. 10761:. 10753:. 10743:24 10741:. 10723:. 10713:. 10703:. 10691:. 10687:. 10670:. 10660:. 10650:78 10648:. 10644:. 10627:. 10619:. 10609:61 10607:. 10590:. 10580:. 10572:. 10560:. 10556:. 10539:. 10531:. 10519:. 10501:. 10493:. 10483:. 10473:71 10471:. 10454:. 10444:. 10434:17 10432:. 10428:. 10411:. 10399:51 10397:. 10393:. 10376:. 10366:. 10356:80 10354:. 10350:. 10333:. 10323:. 10313:15 10311:. 10307:. 10290:. 10282:. 10270:. 10252:. 10240:16 10238:. 10234:. 10218:. 10206:16 10204:. 10200:. 10183:. 10173:. 10163:73 10161:. 10157:. 10140:. 10132:. 10120:. 10102:. 10092:. 10080:10 10078:. 10074:. 10047:. 10037:. 10025:. 10021:. 9971:. 9963:. 9953:26 9951:. 9929:^ 9891:. 9881:. 9873:. 9861:. 9857:. 9833:. 9825:. 9811:. 9807:. 9784:. 9774:. 9766:. 9754:. 9750:. 9733:, 9729:, 9691:. 9679:28 9677:. 9673:. 9649:. 9641:. 9631:24 9629:. 9598:. 9576:. 9566:. 9556:82 9554:. 9550:. 9510:. 9500:. 9488:32 9486:. 9482:. 9459:. 9449:. 9439:. 9427:. 9423:. 9400:. 9390:. 9380:. 9368:. 9364:. 9342:^ 9328:. 9316:58 9314:. 9310:. 9287:. 9275:56 9273:. 9269:. 9246:. 9236:. 9226:. 9214:. 9210:. 9186:. 9178:. 9168:78 9166:. 9143:. 9133:. 9123:. 9111:. 9107:. 9075:. 9065:. 9055:83 9053:. 9049:. 9026:. 9018:. 9006:. 8982:. 8972:. 8962:. 8950:. 8946:. 8923:. 8913:. 8903:17 8901:. 8897:. 8878:. 8866:^ 8759:^ 8709:. 8701:. 8691:72 8689:. 8666:. 8656:. 8646:. 8634:. 8630:. 8607:. 8597:. 8587:. 8575:. 8571:. 8520:. 8510:. 8500:52 8498:. 8494:. 8457:. 8449:. 8439:41 8437:. 8414:. 8404:44 8402:. 8379:. 8369:. 8359:. 8347:. 8343:. 8320:. 8310:. 8300:. 8288:. 8284:. 8261:. 8251:. 8241:. 8229:. 8225:. 8202:. 8192:. 8182:78 8180:. 8176:. 8158:^ 8144:. 8134:. 8124:15 8122:. 8118:. 8061:. 8053:. 8041:. 8029:^ 8015:. 8005:. 7995:82 7993:. 7989:. 7966:. 7956:. 7944:10 7942:. 7938:. 7924:^ 7910:. 7898:16 7896:. 7892:. 7880:^ 7866:. 7856:. 7846:. 7836:11 7834:. 7830:. 7797:. 7787:. 7777:. 7765:. 7761:. 7747:^ 7733:. 7725:. 7715:61 7713:. 7701:^ 7687:. 7677:. 7667:. 7655:. 7651:. 7639:^ 7625:. 7615:. 7605:. 7593:. 7589:. 7565:. 7555:. 7545:. 7533:. 7529:. 7505:. 7495:. 7485:69 7483:. 7479:. 7456:. 7448:. 7438:40 7436:. 7403:. 7393:. 7383:73 7381:. 7377:. 7363:^ 7349:. 7339:. 7329:. 7319:98 7317:. 7313:. 7292:^ 7282:. 7259:. 7249:. 7239:22 7237:. 7233:. 7201:^ 7187:. 7177:. 7167:. 7155:. 7151:. 7139:^ 7125:. 7117:. 7107:. 7097:77 7095:. 7080:^ 7062:. 7039:. 7029:. 7019:. 7007:. 7003:. 6991:^ 6977:. 6967:. 6957:48 6955:. 6951:. 6935:^ 6921:. 6913:. 6903:. 6893:71 6891:. 6887:. 6870:^ 6856:. 6846:. 6834:. 6830:. 6780:. 6772:. 6760:. 6737:. 6729:. 6717:. 6694:. 6682:30 6680:. 6676:. 6653:. 6641:51 6639:. 6635:. 6619:^ 6605:. 6597:. 6585:. 6560:37 6543:^ 6520:. 6510:. 6500:. 6490:10 6488:. 6484:. 6461:. 6453:. 6443:26 6441:. 6437:. 6418:. 6410:. 6398:28 6396:. 6392:. 6366:. 6354:28 6352:. 6348:. 6325:. 6315:. 6305:19 6303:. 6299:. 6276:. 6264:30 6262:. 6258:. 6235:. 6225:. 6215:17 6213:. 6209:. 6192:44 6190:. 6139:. 6131:. 6119:. 6081:. 6069:56 6067:. 6063:. 6047:^ 6033:. 6023:. 6013:90 6011:. 6007:. 5984:. 5974:. 5964:. 5952:. 5948:. 5926:^ 5896:^ 5882:. 5872:. 5860:15 5858:. 5854:. 5836:^ 5822:. 5810:27 5808:. 5804:. 5792:^ 5778:. 5768:. 5754:. 5750:. 5736:^ 5722:. 5712:. 5702:80 5700:. 5696:. 5678:^ 5664:. 5656:. 5644:. 5627:^ 5619:– 5609:. 5601:. 5593:. 5581:. 5567:^ 5553:. 5541:51 5539:. 5535:. 5523:^ 5509:. 5501:. 5489:. 5476:^ 5460:. 5450:. 5440:70 5438:. 5434:. 5422:^ 5403:. 5393:. 5383:. 5371:. 5367:. 5338:. 5334:. 5307:. 5284:. 5276:. 5266:. 5256:74 5254:. 5230:. 5218:. 5194:. 5182:. 5159:. 5149:. 5139:. 5129:10 5127:. 5123:. 5100:. 5088:. 5065:. 5053:57 5051:. 5047:. 5020:. 4997:. 4987:. 4977:. 4965:. 4961:. 4935:^ 4920:. 4910:. 4898:16 4896:. 4892:. 4869:. 4861:. 4849:. 4808:. 4796:. 4784:^ 4770:. 4760:. 4752:. 4740:. 4736:. 4724:^ 4685:. 4675:. 4663:. 4659:. 4602:. 4592:. 4582:18 4580:. 4576:. 4553:. 4512:. 4502:. 4494:. 4484:73 4482:. 4478:. 4453:. 4430:^ 4416:. 4406:. 4396:. 4386:10 4384:. 4380:. 4368:^ 4354:. 4346:. 4334:31 4332:. 4328:. 4316:^ 4302:. 4294:. 4284:43 4282:. 4263:^ 4243:, 4239:, 4235:, 4214:. 4204:. 4194:73 4192:. 4188:. 4172:^ 4158:. 4150:. 4140:74 4138:. 4122:^ 4108:. 4098:. 4084:. 4080:. 4066:^ 4052:^ 4038:^ 4024:. 4012:21 4010:. 4006:. 3980:^ 3970:. 3956:. 3946:. 3936:82 3934:. 3930:. 3903:. 3893:. 3883:. 3873:17 3871:. 3867:. 3803:; 3685:. 3677:. 3667:35 3665:. 3557:P1 3442:J2 3436:J1 3428:I2 3422:I1 3411:K2 3403:LT 3374:IJ 3330:F3 3313:F1 3277:CF 3272:DE 3263:CT 3249:BT 3216:A1 3210:A0 3184:" 2833:, 2814:, 2760:, 2746:, 2595:M3 2579:. 2571:, 2567:, 2563:, 2555:, 2551:, 2547:, 2543:, 2524:, 2516:( 2480:, 2468:, 2460:, 2456:, 2452:, 2448:, 2444:, 2440:, 2410:. 2362:Q* 2344:. 2301:. 2218:, 2214:, 2198:. 1967:) 1920:. 1894:. 1696:. 1657:. 1575:. 1564:. 1486:, 1474:, 1470:, 1315:. 1248:, 1244:, 1240:, 1236:, 1232:, 1228:, 1224:, 1220:, 1216:, 1212:, 1208:, 1204:, 1200:, 1196:, 1192:, 1188:, 1180:, 1176:, 1172:, 1168:, 1164:, 1160:, 1156:, 1152:, 1144:, 1029:. 887:)– 883:, 835:, 831:, 335:, 244:. 225:. 206:, 178:, 174:, 93:Q1 71:, 11066:. 11038:. 11002:. 10988:: 10967:. 10945:: 10924:. 10904:: 10886:. 10866:: 10858:: 10841:. 10817:: 10809:: 10788:. 10769:. 10749:: 10731:. 10707:: 10699:: 10693:7 10678:. 10656:: 10635:. 10615:: 10598:. 10576:: 10568:: 10547:. 10527:: 10509:. 10487:: 10479:: 10462:. 10440:: 10419:. 10405:: 10384:. 10362:: 10341:. 10319:: 10298:. 10278:: 10260:. 10246:: 10228:* 10226:. 10212:: 10191:. 10169:: 10148:. 10128:: 10110:. 10086:: 10055:. 10033:: 9979:. 9959:: 9923:. 9899:. 9877:: 9869:: 9841:. 9819:: 9792:. 9770:: 9762:: 9717:. 9699:. 9685:: 9657:. 9637:: 9613:. 9584:. 9562:: 9518:. 9494:: 9467:. 9443:: 9435:: 9429:6 9408:. 9384:: 9376:: 9370:8 9336:. 9322:: 9295:. 9281:: 9254:. 9230:: 9222:: 9216:7 9194:. 9174:: 9151:. 9127:: 9119:: 9113:7 9083:. 9061:: 9034:. 9014:: 8990:. 8966:: 8958:: 8952:7 8931:. 8909:: 8880:4 8860:. 8846:. 8832:. 8818:. 8784:. 8753:. 8717:. 8697:: 8674:. 8650:: 8642:: 8636:8 8615:. 8591:: 8583:: 8577:8 8556:. 8542:. 8528:. 8506:: 8479:. 8465:. 8445:: 8422:. 8410:: 8387:. 8363:: 8355:: 8349:8 8328:. 8304:: 8296:: 8290:9 8269:. 8245:: 8237:: 8231:9 8210:. 8188:: 8152:. 8130:: 8103:. 8069:. 8049:: 8023:. 8001:: 7974:. 7950:: 7918:. 7904:: 7874:. 7850:: 7842:: 7805:. 7781:: 7773:: 7767:8 7741:. 7721:: 7695:. 7671:: 7663:: 7657:7 7633:. 7609:: 7601:: 7595:8 7573:. 7549:: 7541:: 7535:7 7513:. 7491:: 7464:. 7444:: 7411:. 7389:: 7357:. 7333:: 7325:: 7284:2 7267:. 7245:: 7195:. 7171:: 7163:: 7157:7 7133:. 7111:: 7103:: 7074:. 7070:: 7064:4 7047:. 7023:: 7015:: 7009:9 6985:. 6963:: 6929:. 6907:: 6899:: 6864:. 6842:: 6788:. 6768:: 6745:. 6725:: 6702:. 6688:: 6661:. 6647:: 6613:. 6593:: 6570:. 6566:: 6528:. 6504:: 6496:: 6469:. 6449:: 6404:: 6374:. 6360:: 6333:. 6311:: 6284:. 6270:: 6243:. 6221:: 6147:. 6127:: 6089:. 6075:: 6041:. 6019:: 5992:. 5968:: 5960:: 5954:8 5920:. 5890:. 5866:: 5830:. 5816:: 5786:. 5762:: 5756:2 5730:. 5708:: 5672:. 5652:: 5617:. 5597:: 5589:: 5561:. 5547:: 5517:. 5497:: 5468:. 5446:: 5411:. 5387:: 5379:: 5373:7 5352:. 5346:: 5340:1 5319:. 5315:: 5309:2 5292:. 5270:: 5262:: 5238:. 5226:: 5220:6 5202:. 5190:: 5167:. 5143:: 5135:: 5108:. 5096:: 5073:. 5059:: 5032:. 5028:: 5022:4 5005:. 4981:: 4973:: 4967:8 4928:. 4904:: 4877:. 4857:: 4816:. 4804:: 4778:. 4756:: 4748:: 4718:. 4693:. 4671:: 4624:. 4610:. 4588:: 4520:. 4490:: 4463:. 4424:. 4400:: 4392:: 4362:. 4340:: 4310:. 4290:: 4222:. 4200:: 4166:. 4146:: 4116:. 4092:: 4086:7 4032:. 4018:: 3942:: 3911:. 3887:: 3879:: 3693:. 3673:: 3617:Q 3612:R 3603:O 3596:N 3546:M 3537:S 3515:P 3457:T 3450:L 3394:J 3388:I 3379:K 3365:H 3346:G 3303:F 3298:C 3291:E 3286:D 3258:B 3180:" 3160:) 3156:( 3150:. 3115:e 3108:t 3101:v 2925:( 2882:. 2790:( 2702:) 2698:( 2690:( 2636:. 2593:( 2508:( 2400:. 2250:( 2230:( 2147:( 1974:( 1843:( 1703:( 1531:n 1502:( 1494:( 1482:( 1466:( 1458:- 1345:( 1148:( 1120:, 1113:, 1106:, 1099:, 1092:, 1085:, 1078:, 1060:, 1047:, 1040:. 879:( 166:( 34:. 20:)

Text is available under the Creative Commons Attribution-ShareAlike License. Additional terms may apply.

Index