Knowledge

Human identical sequence

Source 📝

1136: 1374: 44:
genome, which has five HIS elements; other human coronaviruses have one to five. It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts
913:
Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022).
963:
Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022).
1235: 1230: 1225: 1220: 1215: 1210: 1205: 1200: 1195: 1190: 1185: 1174: 1163: 1158: 1336: 1348: 1080: 1013:
Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, Zhang L, Ding C, Luo H, Li Y, Peng L, Zhao L, Peng S, Xiao Y, Dong S, Cao J, Yu W (October 2017).
190: 1415: 1331: 1073: 1124: 1135: 916:"SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network" 1343: 1118: 1112: 1066: 1408: 1144: 966:"Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression" 1106: 376: 1098: 1389: 1444: 1245: 1439: 1401: 1326: 1321: 316: 175: 1168: 8: 40:
network to activate neighboring host genes. The first HIS elements was identified in the
37: 1039: 1014: 990: 965: 940: 915: 1434: 1044: 995: 945: 1179: 1034: 1026: 985: 977: 935: 927: 186: 1030: 931: 1385: 981: 1428: 1015:"MicroRNAs activate gene transcription epigenetically as an enhancer trigger" 881: 801: 496: 491: 321: 180: 1048: 999: 949: 857: 776: 720: 696: 672: 648: 624: 568: 544: 520: 486: 481: 476: 471: 466: 461: 437: 381: 287: 282: 223: 153: 129: 102: 29: 1089: 25: 41: 21: 1058: 195: 50: 1381: 33: 1373: 1149: 277: 97: 1303: 1298: 1293: 1283: 1278: 1268: 1263: 1258: 1253: 201: 108: 1288: 1273: 297: 293: 1313: 46: 1426: 36:(nuclear activating miRNA) through the NamiRNA- 962: 1409: 1349:Coronavirus frameshifting stimulation element 1074: 912: 1337:Coronavirus 3′ stem-loop II-like motif (s2m) 1012: 32:. In pathogenic progression, HIS acts as a 1416: 1402: 1081: 1067: 1038: 989: 939: 970:Signal Transduction and Targeted Therapy 1088: 1427: 1062: 20:is a sequence of RNA elements, 24-27 1368: 908: 906: 904: 13: 14: 1456: 956: 901: 1372: 1134: 1006: 18:human identical sequence (HIS) 1: 1332:Coronavirus 3′ UTR pseudoknot 1031:10.1080/15476286.2015.1112487 894: 236: 56: 1388:. You can help Knowledge by 1344:Coronavirus packaging signal 814: 733: 581: 394: 7: 1145:Viral nonstructural protein 932:10.1016/j.ebiom.2022.103861 335: 312:AGGAGAAUGACAAAAAAAAAAAAAAAA 171:AGGAGAAUGACAAAAAAAAAAAAAAAA 10: 1461: 1367: 982:10.1038/s41392-022-00952-w 93:UGUCUAUGCUAAUGGAGGUAAAGGCU 1312: 1244: 1143: 1132: 1097: 273:UAACAUGCUUAGGAUAAUGGCCUCU 1354:Human identical sequence 1236:nonstructural protein 16 1231:nonstructural protein 15 1226:nonstructural protein 14 1221:nonstructural protein 13 1216:nonstructural protein 12 1211:nonstructural protein 11 1206:nonstructural protein 10 1099:Viral structural protein 875:ACUUUGUAUUGUGUCCUCCUGGAA 851:AAUAUUUUAACAGUACCACGUUAU 834:location in human genome 831:location in virus genome 795:UUGUAUGAGUGAUUUUAUGAGUGA 770:UACAGCUCUUUGUAAAUCUGGUAG 753:location in human genome 750:location in virus genome 714:AACUUUUAUGAUUUUGGUGAUUUU 690:AAGUAAUUGUAUUAAGAUGUUAUC 666:AUAGGCUUAAAUGCUUCUGUUACU 642:GGUGUUUUUGUUGAUGAUGUUGUU 618:UUAUGAUUUUGGUGAUUUUGUUGU 601:location in human genome 598:location in virus genome 562:UAGAUACUGUUAUUUUUAAAAAUA 538:GAUUGGUUGUAUUUUCAUUUUUAU 514:AUUUGACUUUAAAUCUUCAUACUA 455:UUUUCUAAGAAAGAUUGGUAUGAU 431:UUAGAAUUGUUCAAAUGUUAUCUG 414:location in human genome 411:location in virus genome 372:UUCCAUUUGCACAGAGUAUCUUUU 355:location in human genome 352:location in virus genome 256:location in human genome 253:location in virus genome 217:UUGUUGCUGCUAUUUUCUAUUUAA 147:UUAUAUGCCUUAUUUCUUUACUUU 123:UAUAACACAUATAAAAAUACGUGU 76:location in human genome 73:location in virus genome 1246:Viral accessory protein 1201:nonstructural protein 9 1196:nonstructural protein 8 1191:nonstructural protein 7 1186:nonstructural protein 6 1175:nonstructural protein 4 1164:nonstructural protein 2 1159:nonstructural protein 1 28:genomes share with the 53:, ferrets, and cats). 290:: 122356667-122356690 285:: 172887105–172887129 132:: 176597319-176597342 105:: 124017420-124017395 1169:papain-like protease 1125:nucleocapsid protein 884::112451251-112451274 779::122471006-122471029 627::215311768-215311791 479::111192947-111192970 469::151100495-151100518 464::226438633-226438656 440::106816197-106816220 329:same as HIS-SARS2-4 206:same as HIS-SARS1-2 126:12494–12517 in ORF1a 384:: 25635779-25635802 324:: 73670168-73670142 226:: 99693480-99693457 183:: 73670168-73670142 156:: 28949255-28949232 1327:Coronavirus 3′ UTR 1322:Coronavirus 5′ UTR 860::42865576-42865599 804::30510223-30510246 699::19853545-19853568 675::30469931-30469954 651::28254452-28254475 571::81711130-81711153 547::33759646-33759669 523::11718458-11718481 499::30137367-30137390 494::59768424-59768447 489::98386489-98386512 484::94695722-94695745 474::79284823-79284846 220:8610–8633 in ORF1a 150:6766–6789 in ORF1a 1397: 1396: 1362: 1361: 1025:(10): 1326–1334. 892: 891: 837:neighboring genes 812: 811: 756:neighboring genes 731: 730: 604:neighboring genes 579: 578: 417:neighboring genes 392: 391: 358:neighboring genes 333: 332: 259:neighboring genes 234: 233: 79:neighboring genes 1452: 1418: 1411: 1404: 1376: 1369: 1180:3C-like protease 1148:(expressed from 1138: 1119:membrane protein 1113:envelope protein 1083: 1076: 1069: 1060: 1059: 1053: 1052: 1042: 1010: 1004: 1003: 993: 960: 954: 953: 943: 910: 819: 818: 738: 737: 723::1525276-1525299 586: 585: 399: 398: 340: 339: 241: 240: 199: 61: 60: 24:in length, that 1460: 1459: 1455: 1454: 1453: 1451: 1450: 1449: 1425: 1424: 1423: 1422: 1365: 1363: 1358: 1308: 1240: 1147: 1139: 1130: 1093: 1087: 1057: 1056: 1011: 1007: 961: 957: 911: 902: 897: 817: 736: 584: 495: 490: 485: 480: 475: 470: 465: 397: 375:24364–24387 in 338: 315:29717–29743 in 286: 276:15251–15275 in 239: 193: 174:29860–29886 in 59: 12: 11: 5: 1458: 1448: 1447: 1445:Genetics stubs 1442: 1437: 1421: 1420: 1413: 1406: 1398: 1395: 1394: 1377: 1360: 1359: 1357: 1356: 1351: 1346: 1341: 1340: 1339: 1334: 1324: 1318: 1316: 1310: 1309: 1307: 1306: 1301: 1296: 1291: 1286: 1281: 1276: 1271: 1266: 1261: 1256: 1250: 1248: 1242: 1241: 1239: 1238: 1233: 1228: 1223: 1218: 1213: 1208: 1203: 1198: 1193: 1188: 1183: 1177: 1172: 1166: 1161: 1155: 1153: 1141: 1140: 1133: 1131: 1129: 1128: 1122: 1116: 1110: 1103: 1101: 1095: 1094: 1086: 1085: 1078: 1071: 1063: 1055: 1054: 1005: 955: 899: 898: 896: 893: 890: 889: 887: 885: 879: 876: 873: 870: 866: 865: 863: 861: 855: 852: 849: 846: 842: 841: 838: 835: 832: 829: 826: 823: 816: 813: 810: 809: 807: 805: 799: 796: 793: 790: 786: 785: 783: 780: 774: 771: 768: 765: 761: 760: 757: 754: 751: 748: 745: 742: 735: 732: 729: 728: 726: 724: 718: 715: 712: 709: 705: 704: 702: 700: 694: 691: 688: 685: 681: 680: 678: 676: 670: 667: 664: 661: 657: 656: 654: 652: 646: 643: 640: 637: 633: 632: 630: 628: 622: 619: 616: 613: 609: 608: 605: 602: 599: 596: 593: 590: 583: 580: 577: 576: 574: 572: 566: 563: 560: 557: 553: 552: 550: 548: 542: 539: 536: 533: 529: 528: 526: 524: 518: 515: 512: 509: 505: 504: 502: 500: 459: 456: 453: 450: 446: 445: 443: 441: 435: 432: 429: 426: 422: 421: 418: 415: 412: 409: 406: 403: 396: 393: 390: 389: 387: 385: 379: 373: 370: 367: 363: 362: 359: 356: 353: 350: 347: 344: 337: 334: 331: 330: 327: 325: 319: 313: 310: 307: 303: 302: 300: 291: 280: 274: 271: 268: 264: 263: 260: 257: 254: 251: 248: 245: 238: 235: 232: 231: 229: 227: 221: 218: 215: 212: 208: 207: 204: 184: 178: 172: 169: 166: 162: 161: 159: 157: 151: 148: 145: 142: 138: 137: 135: 133: 127: 124: 121: 118: 114: 113: 111: 106: 100: 94: 91: 88: 84: 83: 80: 77: 74: 71: 68: 65: 58: 55: 9: 6: 4: 3: 2: 1457: 1446: 1443: 1441: 1440:Coronaviridae 1438: 1436: 1433: 1432: 1430: 1419: 1414: 1412: 1407: 1405: 1400: 1399: 1393: 1391: 1387: 1384:article is a 1383: 1378: 1375: 1371: 1370: 1366: 1355: 1352: 1350: 1347: 1345: 1342: 1338: 1335: 1333: 1330: 1329: 1328: 1325: 1323: 1320: 1319: 1317: 1315: 1311: 1305: 1302: 1300: 1297: 1295: 1292: 1290: 1287: 1285: 1282: 1280: 1277: 1275: 1272: 1270: 1267: 1265: 1262: 1260: 1257: 1255: 1252: 1251: 1249: 1247: 1243: 1237: 1234: 1232: 1229: 1227: 1224: 1222: 1219: 1217: 1214: 1212: 1209: 1207: 1204: 1202: 1199: 1197: 1194: 1192: 1189: 1187: 1184: 1181: 1178: 1176: 1173: 1170: 1167: 1165: 1162: 1160: 1157: 1156: 1154: 1151: 1146: 1142: 1137: 1126: 1123: 1120: 1117: 1114: 1111: 1108: 1107:spike protein 1105: 1104: 1102: 1100: 1096: 1091: 1084: 1079: 1077: 1072: 1070: 1065: 1064: 1061: 1050: 1046: 1041: 1036: 1032: 1028: 1024: 1020: 1016: 1009: 1001: 997: 992: 987: 983: 979: 975: 971: 967: 959: 951: 947: 942: 937: 933: 929: 925: 921: 917: 909: 907: 905: 900: 888: 886: 883: 880: 877: 874: 871: 868: 867: 864: 862: 859: 856: 853: 850: 847: 844: 843: 839: 836: 833: 830: 827: 824: 821: 820: 808: 806: 803: 800: 797: 794: 791: 788: 787: 784: 781: 778: 775: 772: 769: 766: 763: 762: 758: 755: 752: 749: 746: 743: 740: 739: 727: 725: 722: 719: 716: 713: 710: 707: 706: 703: 701: 698: 695: 692: 689: 686: 683: 682: 679: 677: 674: 671: 668: 665: 662: 659: 658: 655: 653: 650: 647: 644: 641: 638: 635: 634: 631: 629: 626: 623: 620: 617: 614: 611: 610: 606: 603: 600: 597: 594: 591: 588: 587: 575: 573: 570: 567: 564: 561: 558: 555: 554: 551: 549: 546: 543: 540: 537: 534: 531: 530: 527: 525: 522: 519: 516: 513: 510: 507: 506: 503: 501: 498: 493: 488: 483: 478: 473: 468: 463: 460: 457: 454: 451: 448: 447: 444: 442: 439: 436: 433: 430: 427: 424: 423: 419: 416: 413: 410: 407: 404: 401: 400: 388: 386: 383: 380: 378: 374: 371: 368: 365: 364: 360: 357: 354: 351: 348: 345: 342: 341: 328: 326: 323: 320: 318: 314: 311: 308: 305: 304: 301: 299: 295: 292: 289: 284: 281: 279: 275: 272: 269: 266: 265: 261: 258: 255: 252: 249: 246: 243: 242: 230: 228: 225: 222: 219: 216: 213: 210: 209: 205: 203: 197: 192: 188: 185: 182: 179: 177: 173: 170: 167: 164: 163: 160: 158: 155: 152: 149: 146: 143: 140: 139: 136: 134: 131: 128: 125: 122: 119: 116: 115: 112: 110: 107: 104: 101: 99: 96:7570–7595 in 95: 92: 89: 86: 85: 81: 78: 75: 72: 69: 66: 63: 62: 54: 52: 48: 43: 39: 35: 31: 27: 23: 19: 1390:expanding it 1379: 1364: 1353: 1022: 1018: 1008: 973: 969: 958: 923: 920:EBioMedicine 919: 30:human genome 17: 15: 1090:Coronavirus 1019:RNA Biology 878:13139-13162 854:19817-19840 798:24509-24532 773:22827-22850 717:13039-13062 693:12124-12147 669:20754-20777 645:14920-14943 621:13044-13067 565:19844-19867 541:23527-23550 517:26693-26716 458:14044-14067 434:18656-18679 211:HIS-SARS2-5 194: [ 165:HIS-SARS2-4 141:HIS-SARS2-3 117:HIS-SARS2-2 87:HIS-SARS2-1 26:coronavirus 22:nucleotides 1429:Categories 926:: 103861. 895:References 869:HIS-229E-2 845:HIS-229E-1 789:HIS-OC43-2 782:HAS2, ZHX2 764:HIS-OC43-1 708:HIS-NL63-5 684:HIS-NL63-4 660:HIS-NL63-3 636:HIS-NL63-2 612:HIS-NL63-1 556:HIS-HKU1-5 532:HIS-HKU1-4 508:HIS-HKU1-3 449:HIS-HKU1-2 425:HIS-HKU1-1 366:HIS-MERS-1 306:HIS-SARS-2 267:HIS-SARS-1 237:SARS-CoV-1 57:SARS-CoV-2 42:SARS-CoV-2 976:(1): 91. 815:HCoV-229E 734:HCoV-OC43 582:HCoV-NL63 395:HCoV-HKU1 51:pangolins 1435:MicroRNA 1382:genetics 1049:26853707 1000:35304437 950:35124429 828:sequence 747:sequence 595:sequence 408:sequence 349:sequence 336:MERS-CoV 250:sequence 70:sequence 38:enhancer 1092:genomes 1040:5711461 991:8931182 941:8811534 34:NamiRNA 1182:(nsp5) 1171:(nsp3) 1150:ORF1ab 1047:  1037:  998:  988:  948:  938:  825:length 744:length 592:length 405:length 346:length 317:3' UTR 247:length 191:TIMM21 187:FBXO15 176:3' UTR 67:length 1380:This 1304:ORF10 1299:ORF9c 1294:ORF9b 1284:ORF7b 1279:ORF7a 1269:ORF3d 1264:ORF3c 1259:ORF3b 1254:ORF3a 882:chr11 840:note 802:chr13 759:note 607:note 497:chr22 492:chr15 420:note 361:note 322:Chr18 278:ORF1b 262:note 202:CYB5A 198:] 181:Chr18 109:KALRN 98:ORF1a 82:note 1386:stub 1289:ORF8 1274:ORF6 1045:PMID 996:PMID 946:PMID 858:chr8 822:name 777:chr8 741:name 721:chr9 697:chr7 673:chr6 649:chr4 625:chr1 589:name 569:chrX 545:chr4 521:chr4 487:chr7 482:chr7 477:chr5 472:chr5 467:chr4 462:chr1 438:chr1 402:name 382:ChrX 343:name 298:ZHX2 294:HAS2 288:Chr8 283:Chr4 244:name 224:ChrX 154:Chr5 130:Chr3 103:Chr3 64:name 47:bats 16:The 1314:RNA 1127:(N) 1121:(M) 1115:(E) 1109:(S) 1035:PMC 1027:doi 986:PMC 978:doi 936:PMC 928:doi 1431:: 1043:. 1033:. 1023:14 1021:. 1017:. 994:. 984:. 972:. 968:. 944:. 934:. 924:76 922:. 918:. 903:^ 872:24 848:24 792:24 767:24 711:24 687:24 663:24 639:24 615:24 559:24 535:24 511:24 452:24 428:24 369:24 309:27 296:, 270:25 214:24 200:, 196:uk 189:, 168:27 144:24 120:24 90:26 49:, 1417:e 1410:t 1403:v 1392:. 1152:) 1082:e 1075:t 1068:v 1051:. 1029:: 1002:. 980:: 974:7 952:. 930:: 377:S 45:(

Index

nucleotides
coronavirus
human genome
NamiRNA
enhancer
SARS-CoV-2
bats
pangolins
ORF1a
Chr3
KALRN
Chr3
Chr5
3' UTR
Chr18
FBXO15
TIMM21
uk
CYB5A
ChrX
ORF1b
Chr4
Chr8
HAS2
ZHX2
3' UTR
Chr18
S
ChrX
chr1

Text is available under the Creative Commons Attribution-ShareAlike License. Additional terms may apply.