Haplogroup I-M253 - Knowledge

814:. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. The Kowalewko archeological site has been associated with the Wielbark culture. Therefore, the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and 6292: 761: 359:: 29,800 ybp – 25,200 ybp) with TMRCA 4,600 ybp (95 CI: 5,200 ybp – 4,000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2600 BC, this likely puts the ancestor of all living I1 men somewhere in Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion. This suggests that I1 went from being a rare marker to a rather common one in a rapid burst. 201: 2103: 2378: 858:, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia. 2058: 792:. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanic peoples migrated across the Baltic Sea and settled alongside the 2098:

displaced elsewhere or one where indigenous males were reduced in number ... This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea ... These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

840:. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1. This finding is in accordance with the common ancestral origin of the Visigoths and the 284:

Burial oll009 Date: 3930-3750 BP - The fourth ancient I1 sample predating the Nordic Bronze Age (1700–500 BCE) is labelled oll009 and was sequenced in the study titled "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Oll009 is

2118:

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues. This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup

297:

Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia (which also is the case with other haplogroups across Europe). Except for a single DNA sample (SF11), it is also absent from Mesolithic

2069:

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass

321:

Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common

2097:

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were

6951:

K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik

2119:

I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

187:

More than 99% of living men with I1 belong to the DF29 branch which is estimated to have emerged in 2400 BCE. All DF29 men share a common ancestor born between 2500 and 2400 BCE. The oldest ancient individual with I1-DF29 found is Oll009, a man from early

2815:

Underhill PA, Myres NM, Rootsi S, Chow CT, Lin AA, Otillar RP, et al. (2007). "New phylogenetic relationships for Y-chromosome haplogroup I: reappraising its phylogeography and prehistory.". In Mellars P, Boyle K, Bar-Yosef O, Stringe C (eds.).

247:. SF11 was found to have carried 9 of the 312 SNPs that define haplogroup I1. SF11 was classified as I1-Z2699*. SF11 was not assigned to a specific archaeological culture due to the skeleton being found in the Stora Förvar cave on Stora Karlsö. 305:

Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as

828:

Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234. Material findings associated with the Lombards have been excavated in Crypta Balbi.

5042:

Malmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MT, et al. (January 2012). "Finding the founder of Stockholm – a kinship study based on Y-chromosomal, autosomal and mitochondrial DNA".

2082:. The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the 2960:

Lappalainen T, Hannelius U, Salmela E, von Döbeln U, Lindgren CM, Huoponen K, et al. (January 2009). "Population structure in contemporary Sweden—a Y-chromosomal and mitochondrial DNA analysis".

2110:(2003). Haplogroup I-M253 is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale 818:

remains in Collegno, Italy. The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.

2669:

Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe,

285:

dated to the Scandinavian late Neolithic and was found in a burial in Sweden close to Öllsjö on the east coast of Skåne. Similar to RISE179, he carried a high percentage of

4756: 298:

hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying

6787: 254:. BAB5 was found to have carried 1 of the 312 SNPs that define haplogroup I1. BAB5 may also be classified as I1-Z2699*. BAB5 had a genetic affinity to other contemporary 3300:

Lappalainen T, Koivumäki S, Salmela E, Huoponen K, Sistonen P, Savontaus ML, Lahermo P (July 2006). "Regional differences among the Finns: a Y-chromosomal perspective".

825:

in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe.

224:

hunter-gatherers. As of November 2022, only 6 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:

6395: 5777: 4926: 184:, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925). 6385: 4425: 6814:

Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome".

6482: 6465: 318:

in Central Europe; or the steppe itself. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.

3335: 6473: 6081:

Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, Pospieszny Ł, Tõrv M, Lindström J, Götherström A, Storå J, Jakobsson M (October 2019).

3590: 2128: 6632: 6625: 6618: 103:

M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187. It is a primary branch of

866:

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the

329:. A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques. 5919: 5908: 6741: 6736: 2546: 2508: 2454: 2406: 3649: 3790: 3631: 2750: 5872: 5729: 2133:

Through direct testing or testing of their descendants and genealogical evidence, the following notable people have been shown to be I-M253:

273:

labelled RISE179. The grave is located close to Abbekås on the south coast of Skåne RISE179 had a genetic affinity to the populations of the

4643:

Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world".

3102:

Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in

118:

DNA samples it cannot have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a

3106:(2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK. 877:

During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the

2065:". The authors attribute the differences in frequencies of haplogroup I1 to Anglo-Saxon mass migration into England, but not into Wales. 3993:"Ancient mitochondrial DNA from the northern fringe of the Neolithic farming expansion in Europe sheds light on the dispersion process" 3241:

Ebenesersdóttir SS, Sandoval-Velasco M, Gunnarsdóttir ED, Jagadeesan A, Guðmundsdóttir VB, Thordardóttir EL, et al. (June 2018).

2062: 2493: 314:, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the 3869:"YFull | The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" 3117: 768:

Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with

204:

Map of the early Nordic Bronze Age, where I1 first became prominent. The Nordic Bronze Age is often considered ancestral to the

6792: 2221: 372:

M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187

250:

Burial BAB5 Date: 7300-5900 BP – The second is an individual sample from Balatonszemes-Bagodomb labelled BAB5, from Neolithic

5826: 5026: 2825: 3017:

Dupuy BM, Stenersen M, Lu TT, Olaisen B (December 2006). "Geographical heterogeneity of Y-chromosomal lineages in Norway".

6083:"The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" 4091:"The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" 3894:"The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" 3519:"The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" 302:

ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age.

79:

M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187

5607: 5847: 344:, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower 2615: 2600: 2195:; his remains were exhumed and tested in 2002 and found to be I-M253. The House of Bjälbo also provided three kings of 6276: 6124:

Villalba-Mouco V, van de Loosdrecht MS, Posth C, Mora R, Martínez-Moreno J, Rojo-Guerra M, et al. (April 2019).

7011: 5386: 5313: 5284: 3893: 3605: 6933:

Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.

5753: 5143: 6266: 4350:

Zenczak M, Handschuh L, Juras A, Marcinkowska-Swojak M, Philips A, Piontek J, Stolarek I, Figlerowicz M (2017).

293:

and other populations of the Corded Ware horizon. oll009 has Y11204 but does not seem to have Y164553 or Y11205.

4878: 811: 265:

Burial RISE179 Date: 4010-3776 BP – Additionally, the third ancient I1 sample is from an individual found in a

100: 2841:

Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (2008).

2336:

belongs to haplogroup I1-L22. His ancestor Johan Andrésen lived on both sides of the Swedish-Norwegian border.

5458: 5167: 4781: 2159: 6979:

Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.)

6988:

Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)

3932:

Sánchez-Quinto F, Malmström H, Fraser M, Girdland-Flink L, Svensson EM, Simões LG, et al. (May 2019).

236: 6244: 6040:"Ancient DNA reveals lack of continuity between neolithic hunter-gatherers and contemporary Scandinavians" 3174:

Helgason A, Sigureth ardóttir S, Nicholson J, Sykes B, Hill EW, Bradley DG, et al. (September 2000).

177:

All known living members descend from a common ancestor 6 times younger than the common ancestor with I2.

5119: 4199:"Holocene selection for variants associated with cognitive ability: Comparing ancient and modern genomes" 2751:"Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe" 2212: 131: 4353:

Y-Chromosome Haplogroup Assignment Through Next Generation Sequencing of Enriched Ancient DNA Libraries

2399: 2163: 4586:

Martiniano R, Caffell A, Holst M, Hunter-Mann K, Montgomery J, Müldner G, et al. (January 2016).

4284: 3743:"Tracing the genetic origin of Europe's first farmers reveals insights into their social organization" 3723: 2061:

Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "

7021: 7016: 6225: 3362:"New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree" 2585: 2384:

example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

56: 5936:

Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015).

5361: 3813:

Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015).

6455: 2791: 341: 6038:

Malmström H, Gilbert MT, Thomas MG, Brandström M, Storå J, Molnar P, et al. (November 2009).

5410: 5238: 4529:

Olalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, et al. (March 2019).

3991:

Malmström H, Linderholm A, Skoglund P, Storå J, Sjödin P, Gilbert MT, et al. (January 2015).

3741:

Szécsényi-Nagy A, Brandt G, Haak W, Keerl V, Jakucs J, Möller-Rieker S, et al. (April 2015).

2911:

Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008).

2388:

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

836:

in Spain is located in close proximity to a necropolis with a series of tombs associated with the

6658: 5603: 5077: 4950:

Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020).

4830: 4140:"Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences" 3150: 773: 6198: 5801: 4426:"Longobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?" 4089:

Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019).

3517:

Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019).

780:. Current DNA research indicates that I1 was close to non-existent in most of Europe outside of 325:

According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in

6647: 6639: 6379: 6203: 5985:

Brunel S, Bennett EA, Cardin L, Garraud D, Barrand Emam H, Beylier A, et al. (June 2020).

4138:

Poznik GD, Xue Y, Mendez FL, Willems TF, Massaia A, Wilson Sayres MA, et al. (June 2016).

3666:

Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014).

2580: 2358: 2087: 299: 286: 255: 6889:

F-Y27277, sometimes known as F2'4, is both the parent clade of F2 and F4 and a child of F-M89.

5630: 5506: 5482: 3223: 6709: 6555: 4369:"Understanding 6th-century barbarian social organization and migration through paleogenomics" 4198: 3934:"Megalithic tombs in western and northern Neolithic Europe were linked to a kindred society" 3606:"Genomics of Mesolithic Scandinavia reveal colonization routes and high-latitude adaptation" 6748: 6667: 6602: 6546: 6531: 6517: 6438: 6410: 5998: 5949: 5891: 5095: 4963: 4660: 4652: 4599: 4542: 4485: 4380: 3945: 3826: 3679: 3422: 3254: 2705: 2605: 2365: 2174: 315: 104: 5214: 4755:

Capelli C, Redhead N, Abernethy JK, Gratrix F, Wilson JF, Moen T, et al. (May 2003).

4732: 4715: 4164: 3052: 3003: 8: 6259: 4472:

Antonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, et al. (November 2019).

3668:"Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers" 3411:"Large-scale recent expansion of European patrilineages shown by population resequencing" 2749:

Rootsi S, Magri C, Kivisild T, Benuzzi G, Help H, Bermisheva M, et al. (July 2004).

2694:"Large-scale recent expansion of European patrilineages shown by population resequencing" 2595: 2333: 2280: 821:

In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300–400 AD from

356: 326: 307: 274: 6305:

Please help update this article to reflect recent events or newly available information.

6002: 5953: 5579: 4967: 4656: 4603: 4546: 4489: 4384: 3997:

Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences

3949: 3830: 3683: 3426: 3409:

Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015).

3258: 2709: 2692:

Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015).

6839: 6677: 6351: 6334: 6169: 6107: 6082: 6069: 6021: 5987:"Ancient genomes from present-day France unveil 7,000 years of its demographic history" 5986: 5973: 4997: 4794: 4696: 4620: 4587: 4563: 4530: 4506: 4473: 4401: 4368: 4367:

Amorim CE, Vai S, Posth C, Modi A, Koncz I, Hakenbeck S, et al. (September 2018).

4332: 4265: 4219: 4174: 4139: 4115: 4090: 4071: 4017: 3992: 3968: 3933: 3850: 3767: 3742: 3705: 3543: 3518: 3443: 3410: 3386: 3361: 3200: 3175: 2985: 2942: 2872: 2778: 2726: 2693: 2275: 2178: 2137: 311: 290: 6856: 5530: 4772: 4451:"Gender distribution of excavation finds from the Roman imperial and migration period" 4285:"Bronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BC" 3240: 3136: 6908: 6831: 6769: 6764: 6755: 6698: 6689: 6609: 6580: 6540: 6498: 6450: 6368: 6161: 6112: 6061: 6026: 5965: 5186: 5060: 5022: 5001: 4989: 4786: 4737: 4700: 4688: 4625: 4568: 4511: 4450: 4406: 4257: 4223: 4179: 4120: 4063: 4022: 3973: 3842: 3772: 3709: 3697: 3643: 3548: 3448: 3391: 3317: 3282: 3205: 3034: 2989: 2977: 2973: 2934: 2929: 2912: 2864: 2859: 2842: 2821: 2783: 2731: 2315: 2246: 2239: 777: 337: 212:

While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the

189: 123: 6843: 6173: 4336: 4075: 3360:

Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (May 2008).

3030: 2946: 2876: 2290: 6823: 6731: 6489: 6443: 6151: 6141: 6102: 6094: 6073: 6051: 6016: 6006: 5977: 5957: 5831: 5052: 4979: 4971: 4776: 4768: 4727: 4678: 4670: 4615: 4607: 4558: 4550: 4501: 4493: 4396: 4388: 4322: 4209: 4169: 4159: 4151: 4110: 4102: 4053: 4012: 4004: 3963: 3953: 3854: 3834: 3762: 3754: 3687: 3538: 3530: 3438: 3430: 3381: 3373: 3309: 3272: 3262: 3195: 3187: 3132: 3026: 2969: 2924: 2854: 2773: 2765: 2721: 2713: 2610: 2590: 2269: 2207: 2079: 2071: 1063: 1017: 867: 807: 797: 789: 785: 769: 637: 205: 5705:"Björn Andresen: Min passion för mamma blev aldrig besvarad – Katarina Hahr möter" 4798: 2351: 6503: 6229: 5016: 4327: 4310: 3076: 2301: 2216: 2188: 1058: 987: 950: 278: 46: 6126:"Survival of Late Pleistocene Hunter-Gatherer Ancestry in the Iberian Peninsula" 5655: 5056: 4588:"Genomic signals of migration and continuity in Britain before the Anglo-Saxons" 3868: 332:

In 2007, it was suggested that it initially dispersed from the area that is now

240: 6719: 6512: 6345: 6252: 5991:

Proceedings of the National Academy of Sciences of the United States of America

5937: 5680: 4392: 3938:

Proceedings of the National Academy of Sciences of the United States of America

3814: 3313: 2674: 2319: 2253: 259: 159: 143: 119: 31: 6193: 6146: 6125: 6056: 6039: 5612: 4975: 4831:"FamilyTreeDNA – Genetic Testing for Ancestry, Family History & Genealogy" 4674: 2347: 760: 7005: 6964: 6912: 6594: 6588: 6574: 6563: 6526: 6429: 6424: 6415: 6401: 6362: 4311:"Connection between Wielkopolska and the Baltic Sea Region in the Roman Iron" 4261: 3176:"Estimating Scandinavian and Gaelic ancestry in the male settlers of Iceland" 2235: 2231: 2170: 2141: 878: 822: 151: 6011: 4554: 4497: 4058: 4041: 3958: 3692: 3667: 3267: 3242: 2892: 232:

in Spain in 11,466 BCE classified as having a now extinct branch of I-Z2699.

6835: 6274: 6165: 6116: 6098: 6065: 6030: 5969: 5704: 5434: 5064: 4993: 4790: 4741: 4692: 4629: 4572: 4515: 4410: 4183: 4124: 4106: 4067: 4026: 4008: 3977: 3931: 3846: 3776: 3758: 3701: 3591:"Haplotree.info – ancientdna.info. Map based on All Ancient DNA v. 2.07.26" 3552: 3534: 3452: 3395: 3321: 3286: 3209: 3038: 2981: 2938: 2868: 2787: 2735: 2308: 1527: 848: 93: 5829:[Bianca Salming on her relationship with Börje: "Feeling awful"]. 5337: 2234:. Other prominent members of the Lee family of Virginia and Maryland were 810:

has been traced to the Kowalewko burial site in Poland which dates to the

170:, gives the members – and the notional founding patriarch of I1 the name " 2501: 2260: 2184: 886: 781: 270: 217: 163: 6871:

Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4).

6156: 5961: 5292: 5120:"FamilyTreeDNA – Lee Surname DNA Research Project (and Leigh, Lea, etc)" 4611: 4349: 4269: 4245: 3918: 3838: 3566: 6827: 6219:

There are several public access databases featuring I-M253, including:

6137: 5555: 4984: 4902: 4683: 4531:"The genomic history of the Iberian Peninsula over the past 8000 years" 3434: 3377: 3336:"Blood of the Isles: exploring the genetic roots of our tribal history" 3277: 3173: 2717: 2497: 2340: 2148: 871: 855: 841: 221: 213: 155: 147: 142:

province). In terms of national averages, I-M253 is found in 38-39% of

111: 96: 6957: 6911:

was known as "Haplogroup K2". That name has since been re-assigned to

5018:

Viking Rus: Studies on the Presence of Scandinavians in Eastern Europe

4854: 4039: 3661: 3659: 3629: 3469: 3243:"Ancient genomes from Iceland reveal the making of a human population" 6968:, 2017, "Details of the Y-SNP markers included in the minimal Y tree" 4040:

Karlsson AO, Wallerström T, Götherström A, Holmlund G (August 2006).

3493: 2959: 2326: 2225: 2192: 2155: 2083: 1054: 1045: 983: 974: 946: 919: 882: 837: 139: 115: 5531:"Eskilstuna kommun · EM GN398 – Familjen Larsson, Torshälla ca 1900" 4951: 4474:"Ancient Rome: A genetic crossroads of Europe and the Mediterranean" 4351: 4155: 874:, or modern times. It is found in all places invaded by the Norse. 200: 6924:

Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.

4665: 4214: 3656: 3299: 3191: 2769: 2433: 2014: 1067: 1021: 815: 796:. Germanic migration to that area resulted in the formation of the 6813: 6208: 5260: 2910: 2840: 2151: 5616: 4585: 3118:"Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis" 2479: 2475: 2437: 2200: 2090: 2075: 793: 333: 251: 244: 229: 135: 6239: 6037: 5041: 4714:

Weale ME, Weiss DA, Jager RF, Bradman N, Thomas MG (July 2002).

3990: 2820:. Cambridge, UK: McDonald Institute Monographs. pp. 33–42. 2665: 2663: 2249:

belong to a Scandinavian subclade of I1, downstream of I1-Y3549.

2102: 5935: 4356:. Anthropological Genetics. p. Presentation number: AG 16. 3812: 3359: 2196: 1049: 978: 923: 890: 833: 266: 216:, so far DNA studies have only been able to locate it in three 127: 4812: 4754: 3665: 99:. The genetic markers confirmed as identifying I-M253 are the 6080: 4528: 4088: 3740: 3516: 2660: 2646: 2294: 801: 352: 289:

ancestry and had a genetic affinity to the population of the

235:

Burial SF11 Date: 7500 BP – The first is a DNA sample from a

171: 5827:"Bianca Salming om relationen med Börje: "Känner mig hemsk"" 4042:"Y-chromosome diversity in Sweden – a long-time perspective" 114:

as a minor lineage but due to its near-total absence in pre-

5631:"FamilyTreeDNA – The Norway DNA Project – Norgesprosjektet" 4949: 4642: 3053:"FamilyTreeDNA – The Norway DNA Project – Norgesprosjektet" 2620: 2284: 345: 6857:

International Society of Genetic Genealogy (ISOGG; 2015),

6223: 5984: 2748: 2377: 851:

settlement of Britain introduced I1 in the British Isles.

180:

Before a reclassification in 2008, the group was known as

6898:

Haplogroup LT (L298/P326) is also known as Haplogroup K1.

6235:

YHRD : Y-Chromosome STR Haplotype Reference Database

2381: 6234: 5338:"janse /jansen van Rensburg I-M253 genealogy discussion" 3408: 2814: 2691: 5848:"Beethoven DNA Discovery – Find Out If You Are Related" 5507:"FamilyTreeDNA – Sweden DNA Project – Sverigeprojektet" 4246:"The Celts and the Ethnogenesis of the Germanic People" 3016: 3004:"FamilyTreeDNA – Sweden DNA PROJECT – Sverigeprojektet" 2057: 4716:"Y chromosome evidence for Anglo-Saxon mass migration" 4713: 4137: 2106:

Distribution of Y chromosome haplogroups from Capelli

6123: 5144:"FamilyTreeDNA – Grimaldi Genealogy Project at FtDNA" 269:

burial dating to the late Neolithic Dagger Period in

110:

Haplogroup I1 is believed to have been present among

4471: 4250:

Historische Sprachforschung / Historical Linguistics

2224:, an early colonist who emigrated to America on the 2129:

List of haplogroups of historical and famous figures

2063:

Y Chromosome Evidence for Anglo-Saxon Mass Migration

5892:"Reference SNP (refSNP) Cluster Report: rs13447354" 5240:Петр Толстой. Моя родословная. Выпуск от 18.04.2010 5090: 5088: 5873:"Reference SNP (refSNP) Cluster Report: rs9341296" 4366: 5778:"FamilyTreeDNA – Pine/Pyne Genealogy DNA Project" 5656:"Andrésen, Färnskog & Hansen family research" 4782:20.500.11820/8acb01f3-a7c1-45f5-89de-b796266d651e 2426:Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT 7003: 5613:"I Did A DNA Test... (I Guess Im Cancelled Now)" 5085: 4308: 2742: 2423:Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG 5208: 5206: 5204: 2906: 2904: 2542:Source: PS (Michael Hammer and James F. Wilson) 6970:(Access date of these pages: 9 December 2017) 5681:"Personer med namnet Andresen | Släktingar.se" 5187:"Origins and history of Haplogroup I1 (Y-DNA)" 2122: 6260: 4927:"Sample from Homo sapiens – BioSample – NCBI" 3808: 3806: 3804: 6807: 5201: 4757:"A Y chromosome census of the British Isles" 3734: 3630:SF11 – Stora Förvar, Stora Karlsö I-Z2699*. 3293: 3098: 3096: 2953: 2901: 2687: 2685: 2683: 2566:Nucleotide alleles change (mutation): C to T 2528:Nucleotide alleles change (mutation): G to A 861: 6942:Haplogroup P (P295) is also klnown as K2b2. 5938:"Population genomics of Bronze Age Eurasia" 4282: 3815:"Population genomics of Bronze Age Eurasia" 3648:: CS1 maint: numeric names: authors list ( 3224:"The Greater Nordic Regional Y-DNA Project" 2895:Y-DNA Haplogroup I and its Subclades – 2017 2888: 2886: 2641: 2639: 2637: 764:A timeline of the early Germanic expansions 355:suggest I1 (I-M253) was formed 27,500 ybp ( 351:Latest results (January 2022) published by 126:. Today it reaches its peak frequencies in 112:Upper Paleolithic European hunter-gatherers 6850: 6267: 6253: 6199:Danish Demes Regional DNA Project at FTDNA 5459:"FamilyTreeDNA – Morse / Moss DNA Project" 3801: 3470:"Welcome to FamilyTreeDNA Discover (Beta)" 2913:"Migration waves to the Baltic Sea region" 2843:"Migration Waves to the Baltic Sea Region" 2673:, vol. 20 (February 23, 2010), R174–R183. 6883: 6155: 6145: 6106: 6055: 6020: 6010: 5045:Annals of Anatomy – Anatomischer Anzeiger 4983: 4952:"Population genomics of the Viking world" 4780: 4731: 4682: 4664: 4619: 4562: 4505: 4400: 4326: 4213: 4173: 4163: 4114: 4057: 4016: 3967: 3957: 3891: 3766: 3691: 3542: 3442: 3385: 3276: 3266: 3199: 3093: 2928: 2858: 2777: 2725: 2680: 2206:British musician Gordon Sumner, known as 38:27,500 (diversification with I2-FGC77992) 6945: 6880:Haplogroup A1 is also known as A1'2'3'4. 5845: 3907:: 3 – via jakobssonlab.iob.uu.se/. 2883: 2634: 2376: 2154:, said to be the founder of the Russian 2101: 2093:. The main claim by the researchers was 2056: 759: 592:I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1 199: 5824: 5653: 4448: 4243: 4196: 3603: 3464: 3462: 3115: 2070:invasion of eastern Great Britain from 755: 469:I-L205 (L205.1/L939.1/S239.1); I1a1b1a3 348:basin seems like the heartland of I1". 7004: 5384: 5014: 2474:Nucleotide alleles change (mutation): 2432:Nucleotide alleles change (mutation): 6927: 6865: 6248: 4733:10.1093/oxfordjournals.molbev.a004160 4423: 3151:"FamilyTreeDNA – Denmark DNA Project" 2187:, Duke of Sweden of the East Geatish 6918: 6793:Y-DNA haplogroups of historic people 6768: 6763: 6754: 6752: 6747: 6745: 6740: 6735: 6730: 6724: 6717: 6707: 6705: 6695: 6687: 6675: 6673: 6664: 6656: 6614: 6607: 6601: 6599: 6593: 6587: 6585: 6579: 6573: 6561: 6551: 6545: 6539: 6530: 6525: 6516: 6511: 6502: 6497: 6461: 6447: 6330: 6285: 4298:: 7–201 – via diva-portal.org. 3459: 2164:Illarion Ivanovich Vorontsov-Dashkov 322:ancestor that lived around 2600 BC. 6901: 6892: 6874: 6435: 6375: 6358: 5314:"Claas Jansz van Rensburg, SV/PROG" 5212: 5184: 4879:"FamilyTreeDNA – RussiaDNA Project" 2166:) belonged to haplogroup I1-Y15024. 570:A8178, A8182, A8200, A8204; I1a1b3~ 310:before becoming assimilated by the 36:(previously 11,000 BP to 33,000 BP) 13: 6982: 6973: 6936: 5928: 5889: 5870: 5387:"I1: Rolf Nevanlinna (né Neovius)" 4046:European Journal of Human Genetics 3180:American Journal of Human Genetics 2808: 2758:American Journal of Human Genetics 2616:Norse colonization of the Americas 2601:Human Y-chromosome DNA haplogroups 2547:ChrY:12994402..12994402 (+ strand) 2509:ChrY:13006761..13006761 (+ strand) 2455:ChrY:21160339..21160339 (+ strand) 2407:ChrY:13532101..13532101 (+ strand) 14: 7033: 6862:. (Access date: 1 February 2015.) 6182: 5730:"Johan Peter Andresen – Ancestry" 5391:Descendants of haplogroup IJ-M429 4461:: 2 – via ResearchGate.net. 2504:, at the University of Edinburgh) 2274:Swedish scientist and theologian 6290: 6087:Proceedings. Biological Sciences 5913: 5902: 5883: 5864: 5754:"Family tree of Daniel Andresen" 4430:DNAeXplained – Genetic Genealogy 4292:Stockholm Studies in Archaeology 4095:Proceedings. Biological Sciences 3747:Proceedings. Biological Sciences 3724:"familytreedna.com I-Z2699 tree" 3523:Proceedings. Biological Sciences 2974:10.1111/j.1469-1809.2008.00487.x 2930:10.1111/j.1469-1809.2007.00429.x 2860:10.1111/j.1469-1809.2007.00429.x 2343:belongs to haplogroup I1-A13819. 2086:with Anglo-Saxon migrations and 627:I-Z138 (S296/Z138, Z139); I1a2b 484:I-L258 (L258/S335); I1a1b1a4a1a1 6915:, the sibling of Haplogroup LT. 5839: 5818: 5794: 5770: 5746: 5722: 5697: 5673: 5647: 5623: 5596: 5572: 5548: 5523: 5499: 5475: 5451: 5427: 5403: 5378: 5354: 5330: 5306: 5277: 5253: 5231: 5178: 5160: 5136: 5112: 5071: 5035: 5008: 4943: 4919: 4903:"Vår vikingahövding i österled" 4895: 4871: 4847: 4823: 4805: 4748: 4720:Molecular Biology and Evolution 4707: 4636: 4579: 4522: 4465: 4442: 4417: 4360: 4343: 4309:Teska M, Michalowski A (2014). 4302: 4276: 4237: 4190: 4131: 4082: 4033: 3984: 3925: 3911: 3885: 3861: 3783: 3716: 3623: 3597: 3583: 3559: 3510: 3486: 3402: 3353: 3328: 3234: 3216: 3167: 3143: 3109: 3104:Rethinking the Human Revolution 3069: 3045: 3031:10.1016/j.forsciint.2005.11.009 3010: 2996: 2818:Rethinking the Human Revolution 2465:Primer F: TTATTGGCATTTCAGGAAGTG 2252:President of the United States 2158:noble family (including Prince 800:, which is associated with the 746:(Y18119/Z17925, S2304/Z17937); 512:I-L300 (L300/S241); I1a1b1b1a1 6194:Haplogroup I1 Project at FTDNA 5825:Janlind F (20 February 2021). 5047:. Special Issue: Ancient DNA. 4165:11858/00-001M-0000-002A-F024-C 3019:Forensic Science International 2834: 2675:yDNA Haplogroup I: Subclade I1 2522:Primer R: AGCCAAATACCAGTCGTCAC 2519:Primer F: GGTGGGCTGTTTGAAAAAGA 2468:Primer R: GGGTGAGGCAGGAAAATAGC 2398:Source: M (Peter Underhill of 2329:(PewDiePie) belongs to I1-L22. 832:The Pla de l'Horta villa near 1: 4773:10.1016/S0960-9822(03)00373-7 3632:"Haplotree.info sample: SF11" 3474:FamilyTreeDNA Discover (Beta) 3137:10.1016/S0531-5131(03)01635-2 3125:International Congress Series 2627: 2557:Primer F: GGAGAAAAGGTGAGAAACC 2268:Icelandic historian and poet 2160:Mikhail Semyonovich Vorontsov 239:with the label SF11 found on 6277:Y-chromosome DNA haplogroups 5291:(in Swedish). Archived from 4328:10.15388/ArchLit.2013.0.2641 2414:Total size (base pairs): 400 2322:Larsson belong to I1-Y24470. 2297:businessman and millionaire. 2287:patriotic figure and mystic. 362: 237:Scandinavian hunter-gatherer 7: 6327: 6275:Phylogenetic tree of human 5580:"Familjen Larssons Anfäder" 5483:"Peter Morse's Family Tree" 5057:10.1016/j.aanat.2011.03.014 4197:Woodley M (February 2017). 3081:Norway DNA Norgesprosjektet 2573: 2450:Source: M (Peter Underhill) 2123:Prominent members of I-M253 338:Prof. Dr. Kenneth Nordtvedt 228:A hunter-gatherer from the 10: 7038: 6859:Y-DNA Haplogroup Tree 2015 6761: 6728: 6685: 6654: 6645: 6637: 6630: 6623: 6616: 6571: 6537: 6523: 6509: 6495: 6479: 6463: 6332: 4393:10.1038/s41467-018-06024-4 4283:Bergerbrant S (May 2007). 3314:10.1016/j.gene.2006.03.004 2560:Primer R: GGACAAGGGGCAGATT 2372: 2126: 573:F13534.2/Y17263.2; I1a1b4~ 195: 34:(today's diversification) 6782: 6560: 6553: 6487: 6470: 6454: 6449: 6442: 6437: 6428: 6423: 6421: 6414: 6409: 6407: 6400: 6393: 6391: 6384: 6377: 6367: 6360: 6350: 6343: 6341: 6325: 6299:This article needs to be 6283: 6209:British Isles DNA Project 6204:Haplogroup I-P109 Project 6147:10.1016/j.cub.2019.02.006 6057:10.1016/j.cub.2009.09.017 4976:10.1038/s41586-020-2688-8 4675:10.1038/s41586-020-2688-8 3892:Malmstrom H (July 2019). 2586:Genetic history of Europe 2411:Position (base pair): 283 2140:, founding father of the 1382:Lappalainen et al. 20089 1370:Finland: Satakunta region 862:Geographical distribution 503:CTS11603/S4744; I1a1b1b~ 440:CTS11651/Z2338; I1a1b1a~ 437:I-L22 (L22/S142); I1a1b1 138:(more than 50 percent in 75: 63: 52: 42: 26: 21: 5435:"Morse/Moss DNA Testing" 5411:"Arne Edvard Nevanlinna" 3619:: 6 – via Biorxiv. 2962:Annals of Human Genetics 2917:Annals of Human Genetics 2847:Annals of Human Genetics 1973:Ukraine: Ivanovo-Frankiv 1908:Lappalainen et al. 2009 1891:Lappalainen et al. 2009 1874:Lappalainen et al. 2008 1796:Lappalainen et al. 2008 1580:Lappalainen et al. 2008 1562:Lappalainen et al. 2008 1365:Lappalainen et al. 2008 1347:Lappalainen et al. 2008 1329:Lappalainen et al. 2006 1312:Lappalainen et al. 2008 589:I-Z59 (S246/Z59); I1a2a 342:Montana State University 158:males, and about 28% of 130:(52 percent of males in 43:Possible place of origin 7012:Human Y-DNA haplogroups 6907:Between 2002 and 2008, 6215:General Y-DNA databases 6012:10.1073/pnas.1918034117 5846:Mercedes (2023-03-26). 5654:Tovseth A (June 2018). 5215:"Haplogroup I1 (Y-DNA)" 5096:"Mayflower DNA Project" 4555:10.1126/science.aav4040 4498:10.1126/science.aay6826 4449:Labudde D (July 2015). 4059:10.1038/sj.ejhg.5201651 3959:10.1073/pnas.1818037116 3693:10.1126/science.1253448 3268:10.1126/science.aar2625 2649:. Yfull.com. 2022-04-06 2181:) belonged to I1-S2077. 2175:Sviatopolk the Accursed 1896:Sweden: Västra Götaland 1194:Karachanak et al. 2013 567:FGC10477/Y13056; I1a1b2 455:I-Y29630; I1a1b1a1e2d2~ 452:I-Y11203; I1a1b1a1e2d~ 27:Possible time of origin 16:Y chromosome haplogroup 6188:Haplogroup I databases 6099:10.1098/rspb.2019.1528 4424:Estes R (2020-10-16). 4107:10.1098/rspb.2019.1528 4009:10.1098/rstb.2013.0373 3759:10.1098/rspb.2015.0339 3535:10.1098/rspb.2019.1528 2581:European ethnic groups 2385: 2300:Finnish mathematician 2115: 2100: 2066: 2051:Underhill et al. 2007 2031:Underhill et al. 2007 2008:Underhill et al. 2007 1988:Underhill et al. 2007 1968:Underhill et al. 2007 1948:Underhill et al. 2007 1856:Underhill et al. 2007 1816:Underhill et al. 2007 1778:Underhill et al. 2007 1758:Underhill et al. 2007 1738:Underhill et al. 2007 1718:Underhill et al. 2007 1698:Underhill et al. 2007 1678:Underhill et al. 2007 1658:Underhill et al. 2007 1618:Stenersen et al. 2006 1600:Underhill et al. 2007 1522:Underhill et al. 2007 1482:Underhill et al. 2007 1462:Underhill et al. 2007 1402:Underhill et al. 2007 1274:Underhill et al. 2007 1254:Underhill et al. 2007 1214:Underhill et al. 2007 1154:Underhill et al. 2007 1134:Underhill et al. 2007 1114:Underhill et al. 2007 1094:Battaglia et al. 2008 1012:Battaglia et al. 2008 968:Battaglia et al. 2008 941:Battaglia et al. 2008 772:and are linked to the 765: 680:I-Y2245 (Y2245/PR683) 449:I-S14887; I1a1b1a1e2~ 209: 132:Västra Götaland County 5385:olenus (2018-03-30). 5168:"Jackson DNA Project" 4813:"Founding Father DNA" 4592:Nature Communications 4373:Nature Communications 3415:Nature Communications 3139:– via isfg.org. 2698:Nature Communications 2498:University of Arizona 2380: 2105: 2095: 2060: 1427:France (Low Normandy) 763: 708:I-BY62 (BY62); I1a3a3 494:FGC12562; I1a1b1a4a3~ 478:CTS2208; I1a1b1a4a1~ 300:Western Steppe Herder 287:Western Steppe-Herder 203: 5852:Who are You Made Of? 5660:Kjellivar.tripod.com 5362:"Rolf H. Nevanlinna" 5078:The British Invasion 4315:Archaeologia Lituana 3077:"Y-DNA Haplogrupper" 2606:Late Glacial Maximum 2366:Ludwig van Beethoven 2314:Swedish Footballers 2230:Confederate general 2203:in the 14th century. 1039:Pericic et al. 2005 756:Historical expansion 595:I-Z140 (Z140, Z141) 481:I-L287; I1a1b1a4a1a 446:I-Y3662; I1a1b1a1e~ 316:Funnelbeaker culture 22:Haplogroup I1 (M253) 6788:Y-DNA by population 6703: 6003:2020PNAS..11712791B 5962:10.1038/nature14507 5954:2015Natur.522..167A 5185:Hay M (July 2020). 5174:. 11 December 2020. 4968:2020Natur.585..390M 4855:"Faderslinjen, DNA" 4657:2020Natur.585..390M 4612:10.1038/ncomms10326 4604:2016NatCo...710326M 4547:2019Sci...363.1230O 4490:2019Sci...366..708A 4385:2018NatCo...9.3547A 4244:Schmidt KH (1991). 3950:2019PNAS..116.9469S 3839:10.1038/nature14507 3831:2015Natur.522..167A 3684:2014Sci...344..747S 3427:2015NatCo...6.7152B 3259:2018Sci...360.1028E 3253:(6392): 1028–1032. 3116:Sanchez JJ (2004). 2710:2015NatCo...6.7152B 2596:History of Normandy 2400:Stanford University 2281:Siener van Rensburg 1928:Rootsi et al. 2004 1836:Rootsi et al. 2004 1723:Russia: Arkhangelsk 1502:Rootsi et al. 2004 1442:Rootsi et al. 2004 1294:Rootsi et al. 2004 1234:Rootsi et al. 2004 1174:Rootsi et al. 2004 1092:Pericic et al. 2005 327:Chalcolithic Europe 275:Corded Ware culture 166:, in his 2006 book 71:I1c (Y18119/Z17925) 6828:10.1002/humu.22468 6554: 6335:Y-chromosomal Adam 6228:2011-01-04 at the 6093:(1912): 20191528. 5081:Finding Your Roots 4101:(1912): 20191528. 4003:(1660): 20130373. 3604:Gunther T (2017). 3529:(1912): 20191528. 3435:10.1038/ncomms8152 3378:10.1101/gr.7172008 2898:(31 January 2017). 2718:10.1038/ncomms8152 2677:, Family Tree DNA, 2386: 2357:American colonist 2350:Ice hockey player 2307:American inventor 2276:Emanuel Swedenborg 2215:, Governor of the 2199:, and one king of 2179:Vladimir the Great 2138:Alexander Hamilton 2116: 2067: 1317:Finland (national) 766: 491:I-L813; I1a1b1a4a2 472:CTS6868; I1a1b1a4 312:Battle Axe culture 291:Battle Axe culture 210: 168:Blood of the Isles 76:Defining mutations 30:3,170–4,600–5,070 6999: 6998: 6961:, 2017, "K-M2335" 6959:YFull YTree v5.08 6909:Haplogroup T-M184 6777: 6776: 6722: 6712: 6702: 6693: 6681: 6670: 6662: 6650: 6642: 6635: 6628: 6621: 6566: 6485: 6477: 6468: 6398: 6382: 6365: 6348: 6320: 6319: 5782:familytreedna.com 5635:familytreedna.com 5584:hosserudkullen.se 5535:Eskilstuna kommun 5511:familytreedna.com 5463:familytreedna.com 5148:familytreedna.com 5124:familytreedna.com 5028:978-90-04-13874-2 5015:Duczko W (2004). 4883:familytreedna.com 4835:familytreedna.com 4541:(6432): 1230–34. 3155:familytreedna.com 3057:familytreedna.com 2923:(Pt 3): 337–348. 2827:978-1-902937-46-5 2531:Region: ARSDP 2325:Swedish YouTuber 2316:Sebastian Larsson 2247:House of Grimaldi 2240:Richard Henry Lee 2055: 2054: 2036:Ukraine: Bilhorod 1993:Ukraine: Hmelnitz 1879:Sweden (national) 1861:Sweden (national) 1783:Russia: Karelians 1763:Russia: Karelians 1638:Cann et al. 2002 1623:Russia (national) 1422:Cann et al. 2002 778:Nordic Bronze Age 475:I-Z74; I1a1b1a4a 466:CTS6017; I1a1b1a2 443:I-P109; I1a1b1a1 414:I-M227; I1a1a1a1a 404:FGC20030; I1a1a~ 398:(CTS6364/Z2336); 373: 256:Neolithic farmers 190:Bronze Age Sweden 124:Nordic Bronze Age 105:Haplogroup I-M170 86:Haplogroup I-M253 83: 82: 37: 7029: 7022:Stone Age Europe 7017:Nordic Stone Age 6989: 6986: 6980: 6977: 6971: 6949: 6943: 6940: 6934: 6931: 6925: 6922: 6916: 6905: 6899: 6896: 6890: 6887: 6881: 6878: 6872: 6869: 6863: 6854: 6848: 6847: 6811: 6718: 6708: 6696: 6688: 6676: 6666: 6657: 6646: 6638: 6631: 6624: 6617: 6562: 6481: 6472: 6464: 6394: 6378: 6361: 6344: 6328: 6315: 6312: 6306: 6294: 6293: 6286: 6269: 6262: 6255: 6246: 6245: 6177: 6159: 6149: 6120: 6110: 6077: 6059: 6034: 6024: 6014: 5997:(23): 12791–98. 5981: 5948:(7555): 167–72. 5922: 5917: 5911: 5906: 5900: 5899: 5887: 5881: 5880: 5868: 5862: 5861: 5859: 5858: 5843: 5837: 5836: 5832:Goteborgs-Posten 5822: 5816: 5815: 5813: 5812: 5806:geni_family_tree 5802:"James Pine, Sr" 5798: 5792: 5791: 5789: 5788: 5774: 5768: 5767: 5765: 5764: 5750: 5744: 5743: 5741: 5740: 5726: 5720: 5719: 5717: 5716: 5701: 5695: 5694: 5692: 5691: 5677: 5671: 5670: 5668: 5666: 5651: 5645: 5644: 5642: 5641: 5627: 5621: 5620: 5600: 5594: 5593: 5591: 5590: 5576: 5570: 5569: 5567: 5566: 5556:"I-Y24470 YTree" 5552: 5546: 5545: 5543: 5542: 5527: 5521: 5520: 5518: 5517: 5503: 5497: 5496: 5494: 5493: 5479: 5473: 5472: 5470: 5469: 5455: 5449: 5448: 5446: 5445: 5439:morsesociety.org 5431: 5425: 5424: 5422: 5421: 5415:geni_family_tree 5407: 5401: 5400: 5398: 5397: 5382: 5376: 5375: 5373: 5372: 5366:geni_family_tree 5358: 5352: 5351: 5349: 5348: 5342:geni_family_tree 5334: 5328: 5327: 5325: 5324: 5318:geni_family_tree 5310: 5304: 5303: 5301: 5300: 5281: 5275: 5274: 5272: 5271: 5257: 5251: 5250: 5249: 5248: 5235: 5229: 5228: 5226: 5225: 5210: 5199: 5198: 5182: 5176: 5175: 5164: 5158: 5157: 5155: 5154: 5140: 5134: 5133: 5131: 5130: 5116: 5110: 5109: 5107: 5106: 5100:mayflowerdna.org 5092: 5083: 5075: 5069: 5068: 5039: 5033: 5032: 5012: 5006: 5005: 4987: 4962:(7825): 390–96. 4947: 4941: 4940: 4938: 4937: 4931:ncbi.nlm.nih.gov 4923: 4917: 4916: 4914: 4913: 4899: 4893: 4892: 4890: 4889: 4875: 4869: 4868: 4866: 4865: 4851: 4845: 4844: 4842: 4841: 4827: 4821: 4820: 4809: 4803: 4802: 4784: 4752: 4746: 4745: 4735: 4711: 4705: 4704: 4686: 4668: 4651:(7825): 390–96. 4640: 4634: 4633: 4623: 4583: 4577: 4576: 4566: 4526: 4520: 4519: 4509: 4484:(6466): 708–14. 4469: 4463: 4462: 4446: 4440: 4439: 4437: 4436: 4421: 4415: 4414: 4404: 4364: 4358: 4357: 4347: 4341: 4340: 4330: 4306: 4300: 4299: 4289: 4280: 4274: 4273: 4241: 4235: 4234: 4232: 4230: 4217: 4203: 4194: 4188: 4187: 4177: 4167: 4135: 4129: 4128: 4118: 4086: 4080: 4079: 4061: 4037: 4031: 4030: 4020: 3988: 3982: 3981: 3971: 3961: 3929: 3923: 3922: 3919:"I-Y11204 YTree" 3915: 3909: 3908: 3901:Uppsala Genomics 3898: 3889: 3883: 3882: 3880: 3879: 3865: 3859: 3858: 3825:(7555): 167–72. 3810: 3799: 3798: 3787: 3781: 3780: 3770: 3738: 3732: 3731: 3720: 3714: 3713: 3695: 3678:(6185): 747–50. 3663: 3654: 3653: 3647: 3639: 3627: 3621: 3620: 3610: 3601: 3595: 3594: 3587: 3581: 3580: 3578: 3577: 3567:"I-Y11204 YTree" 3563: 3557: 3556: 3546: 3514: 3508: 3507: 3505: 3504: 3490: 3484: 3483: 3481: 3480: 3466: 3457: 3456: 3446: 3406: 3400: 3399: 3389: 3357: 3351: 3350: 3348: 3347: 3332: 3326: 3325: 3297: 3291: 3290: 3280: 3270: 3238: 3232: 3231: 3220: 3214: 3213: 3203: 3171: 3165: 3164: 3162: 3161: 3147: 3141: 3140: 3122: 3113: 3107: 3100: 3091: 3090: 3088: 3087: 3073: 3067: 3066: 3064: 3063: 3049: 3043: 3042: 3014: 3008: 3007: 3000: 2994: 2993: 2957: 2951: 2950: 2932: 2908: 2899: 2890: 2881: 2880: 2862: 2838: 2832: 2831: 2812: 2806: 2805: 2803: 2802: 2796: 2790:. Archived from 2781: 2755: 2746: 2740: 2739: 2729: 2689: 2678: 2667: 2658: 2657: 2655: 2654: 2643: 2611:Neolithic Europe 2591:Germanic peoples 2364:German composer 2270:Snorri Sturluson 2222:William Brewster 2213:William Bradford 2080:Migration Period 2072:northern Germany 1743:Russia: Cossacks 1683:Russia: Smolensk 1663:Russia: Kostroma 1064:Kosovo Albanians 1018:Kosovo Albanians 896: 895: 868:Migration Period 798:Wielbark culture 790:Migration Period 786:northern Germany 776:speakers of the 770:Germanic peoples 654:I-BY351; I1a3a2 651:I-L849.2; I1a3a1 434:CTS10028; I1a1b 371: 154:males, 34.5% of 150:males, 34.8% of 88:, also known as 69:I1b (S249/Z131); 67:I1a (DF29/S438); 35: 19: 18: 7037: 7036: 7032: 7031: 7030: 7028: 7027: 7026: 7002: 7001: 7000: 6995: 6994: 6993: 6992: 6987: 6983: 6978: 6974: 6950: 6946: 6941: 6937: 6932: 6928: 6923: 6919: 6906: 6902: 6897: 6893: 6888: 6884: 6879: 6875: 6870: 6866: 6855: 6851: 6812: 6808: 6803: 6797: 6778: 6321: 6316: 6310: 6307: 6304: 6295: 6291: 6279: 6273: 6230:Wayback Machine 6185: 6180: 6130:Current Biology 6050:(20): 1758–62. 6044:Current Biology 5931: 5929:Further reading 5926: 5925: 5918: 5914: 5907: 5903: 5888: 5884: 5869: 5865: 5856: 5854: 5844: 5840: 5823: 5819: 5810: 5808: 5800: 5799: 5795: 5786: 5784: 5776: 5775: 5771: 5762: 5760: 5752: 5751: 5747: 5738: 5736: 5728: 5727: 5723: 5714: 5712: 5703: 5702: 5698: 5689: 5687: 5679: 5678: 5674: 5664: 5662: 5652: 5648: 5639: 5637: 5629: 5628: 5624: 5611: 5608:Wayback Machine 5601: 5597: 5588: 5586: 5578: 5577: 5573: 5564: 5562: 5554: 5553: 5549: 5540: 5538: 5529: 5528: 5524: 5515: 5513: 5505: 5504: 5500: 5491: 5489: 5481: 5480: 5476: 5467: 5465: 5457: 5456: 5452: 5443: 5441: 5433: 5432: 5428: 5419: 5417: 5409: 5408: 5404: 5395: 5393: 5383: 5379: 5370: 5368: 5360: 5359: 5355: 5346: 5344: 5336: 5335: 5331: 5322: 5320: 5312: 5311: 5307: 5298: 5296: 5283: 5282: 5278: 5269: 5267: 5261:"I-BY229 YTree" 5259: 5258: 5254: 5246: 5244: 5237: 5236: 5232: 5223: 5221: 5211: 5202: 5183: 5179: 5166: 5165: 5161: 5152: 5150: 5142: 5141: 5137: 5128: 5126: 5118: 5117: 5113: 5104: 5102: 5094: 5093: 5086: 5076: 5072: 5040: 5036: 5029: 5013: 5009: 4948: 4944: 4935: 4933: 4925: 4924: 4920: 4911: 4909: 4901: 4900: 4896: 4887: 4885: 4877: 4876: 4872: 4863: 4861: 4853: 4852: 4848: 4839: 4837: 4829: 4828: 4824: 4811: 4810: 4806: 4761:Current Biology 4753: 4749: 4712: 4708: 4641: 4637: 4584: 4580: 4527: 4523: 4470: 4466: 4447: 4443: 4434: 4432: 4422: 4418: 4365: 4361: 4348: 4344: 4307: 4303: 4287: 4281: 4277: 4242: 4238: 4228: 4226: 4201: 4195: 4191: 4156:10.1038/ng.3559 4144:Nature Genetics 4136: 4132: 4087: 4083: 4038: 4034: 3989: 3985: 3944:(19): 9469–74. 3930: 3926: 3917: 3916: 3912: 3896: 3890: 3886: 3877: 3875: 3867: 3866: 3862: 3811: 3802: 3791:"BAB5 I-Z2699*" 3789: 3788: 3784: 3739: 3735: 3722: 3721: 3717: 3664: 3657: 3641: 3640: 3628: 3624: 3608: 3602: 3598: 3589: 3588: 3584: 3575: 3573: 3565: 3564: 3560: 3515: 3511: 3502: 3500: 3492: 3491: 3487: 3478: 3476: 3468: 3467: 3460: 3407: 3403: 3366:Genome Research 3358: 3354: 3345: 3343: 3340:History Ireland 3334: 3333: 3329: 3298: 3294: 3239: 3235: 3222: 3221: 3217: 3172: 3168: 3159: 3157: 3149: 3148: 3144: 3120: 3114: 3110: 3101: 3094: 3085: 3083: 3075: 3074: 3070: 3061: 3059: 3051: 3050: 3046: 3015: 3011: 3002: 3001: 2997: 2958: 2954: 2909: 2902: 2891: 2884: 2839: 2835: 2828: 2813: 2809: 2800: 2798: 2794: 2753: 2747: 2743: 2690: 2681: 2671:Current Biology 2668: 2661: 2652: 2650: 2645: 2644: 2635: 2630: 2625: 2576: 2502:James F. Wilson 2375: 2339:American actor 2327:Felix Kjellberg 2318:and his father 2302:Rolf Nevanlinna 2259:Russian writer 2217:Plymouth Colony 2189:House of Bjälbo 2131: 2125: 1703:Russia: Voronez 1544:Trofimova 2015 1119:Belarus: Vitbsk 1093: 1080:13.73%=(32/233) 1062: 1059:North Macedonia 1053: 1000:19.33%=(23/119) 988:North Macedonia 982: 951:North Macedonia 911:I1a1a (I-M227) 864: 758: 648:I-BY151; I1a3a 601:I-F2642 (F2642) 426:Y11221; I1a1a3~ 407:S4767; I1a1a1~ 365: 279:Unetice culture 198: 70: 68: 47:Northern Europe 17: 12: 11: 5: 7035: 7025: 7024: 7019: 7014: 6997: 6996: 6991: 6990: 6981: 6972: 6944: 6935: 6926: 6917: 6900: 6891: 6882: 6873: 6864: 6849: 6816:Human Mutation 6805: 6804: 6799: 6798: 6796: 6795: 6790: 6784: 6783: 6780: 6779: 6775: 6774: 6772: 6767: 6762: 6759: 6758: 6753: 6751: 6746: 6744: 6739: 6734: 6729: 6726: 6725: 6723: 6716: 6714: 6706: 6704: 6694: 6686: 6683: 6682: 6674: 6672: 6663: 6655: 6652: 6651: 6644: 6636: 6629: 6622: 6615: 6613: 6606: 6600: 6598: 6592: 6586: 6584: 6578: 6572: 6569: 6568: 6559: 6552: 6550: 6544: 6538: 6535: 6534: 6529: 6524: 6521: 6520: 6515: 6510: 6507: 6506: 6501: 6496: 6493: 6492: 6486: 6478: 6469: 6462: 6459: 6458: 6453: 6448: 6446: 6441: 6436: 6433: 6432: 6427: 6422: 6419: 6418: 6413: 6408: 6405: 6404: 6399: 6392: 6389: 6388: 6383: 6376: 6373: 6372: 6366: 6359: 6356: 6355: 6349: 6342: 6339: 6338: 6331: 6326: 6323: 6322: 6318: 6317: 6298: 6296: 6289: 6284: 6281: 6280: 6272: 6271: 6264: 6257: 6249: 6243: 6242: 6237: 6232: 6217: 6216: 6212: 6211: 6206: 6201: 6196: 6190: 6189: 6184: 6183:External links 6181: 6179: 6178: 6140:: 1169–77.e7. 6121: 6078: 6035: 5982: 5932: 5930: 5927: 5924: 5923: 5912: 5901: 5882: 5863: 5838: 5817: 5793: 5769: 5745: 5721: 5709:Radio Sveriges 5696: 5672: 5646: 5622: 5595: 5571: 5547: 5522: 5498: 5474: 5450: 5426: 5402: 5377: 5353: 5329: 5305: 5276: 5252: 5230: 5200: 5177: 5159: 5135: 5111: 5084: 5070: 5034: 5027: 5007: 4942: 4918: 4894: 4870: 4846: 4822: 4804: 4767:(11): 979–84. 4747: 4726:(7): 1008–21. 4706: 4666:10.1101/703405 4635: 4578: 4521: 4464: 4441: 4416: 4359: 4342: 4301: 4275: 4236: 4215:10.1101/109678 4189: 4130: 4081: 4032: 3983: 3924: 3910: 3884: 3860: 3800: 3795:haplotree.info 3782: 3733: 3715: 3655: 3636:haplotree.info 3622: 3596: 3582: 3558: 3509: 3494:"I-DF29 YTree" 3485: 3458: 3401: 3352: 3327: 3292: 3233: 3215: 3192:10.1086/303046 3186:(3): 697–717. 3166: 3142: 3108: 3092: 3068: 3044: 3009: 2995: 2952: 2900: 2882: 2853:(3): 337–348. 2833: 2826: 2807: 2770:10.1086/422196 2741: 2679: 2659: 2632: 2631: 2629: 2626: 2624: 2623: 2618: 2613: 2608: 2603: 2598: 2593: 2588: 2583: 2577: 2575: 2572: 2571: 2570: 2567: 2564: 2561: 2558: 2555: 2552: 2549: 2543: 2540: 2533: 2532: 2529: 2526: 2523: 2520: 2517: 2514: 2511: 2505: 2494:Michael Hammer 2490: 2483: 2482: 2472: 2469: 2466: 2463: 2460: 2457: 2451: 2448: 2441: 2440: 2430: 2427: 2424: 2421: 2418: 2415: 2412: 2409: 2403: 2396: 2374: 2371: 2370: 2369: 2362: 2355: 2344: 2337: 2334:Björn Andrésen 2332:Swedish actor 2330: 2323: 2312: 2305: 2298: 2291:Björn Wahlroos 2288: 2278: 2272: 2265: 2264: 2257: 2254:Andrew Jackson 2250: 2243: 2228: 2219: 2210: 2204: 2182: 2167: 2145: 2127:Main article: 2124: 2121: 2053: 2052: 2049: 2046: 2043: 2040: 2037: 2033: 2032: 2029: 2026: 2023: 2020: 2017: 2010: 2009: 2006: 2003: 2000: 1997: 1994: 1990: 1989: 1986: 1983: 1980: 1977: 1974: 1970: 1969: 1966: 1963: 1960: 1957: 1954: 1950: 1949: 1946: 1943: 1940: 1937: 1934: 1930: 1929: 1926: 1923: 1920: 1917: 1914: 1910: 1909: 1906: 1904: 1901: 1899: 1897: 1893: 1892: 1889: 1887: 1884: 1882: 1880: 1876: 1875: 1872: 1870: 1869:35.6% (57/160) 1867: 1865: 1862: 1858: 1857: 1854: 1851: 1848: 1845: 1842: 1838: 1837: 1834: 1831: 1828: 1825: 1822: 1818: 1817: 1814: 1811: 1808: 1805: 1802: 1798: 1797: 1794: 1792: 1789: 1787: 1784: 1780: 1779: 1776: 1773: 1770: 1767: 1764: 1760: 1759: 1756: 1753: 1750: 1747: 1744: 1740: 1739: 1736: 1733: 1730: 1727: 1724: 1720: 1719: 1716: 1713: 1710: 1707: 1704: 1700: 1699: 1696: 1693: 1690: 1687: 1684: 1680: 1679: 1676: 1673: 1670: 1667: 1664: 1660: 1659: 1656: 1653: 1650: 1647: 1644: 1640: 1639: 1636: 1633: 1630: 1627: 1624: 1620: 1619: 1616: 1614: 1613:37% (653/1766) 1611: 1609: 1606: 1602: 1601: 1598: 1595: 1592: 1589: 1586: 1582: 1581: 1578: 1576: 1573: 1571: 1568: 1564: 1563: 1560: 1558: 1555: 1553: 1550: 1546: 1545: 1542: 1539: 1536: 1533: 1530: 1524: 1523: 1520: 1517: 1514: 1511: 1508: 1504: 1503: 1500: 1497: 1494: 1491: 1488: 1484: 1483: 1480: 1477: 1474: 1471: 1468: 1464: 1463: 1460: 1457: 1454: 1451: 1448: 1444: 1443: 1440: 1437: 1434: 1431: 1428: 1424: 1423: 1420: 1417: 1414: 1411: 1408: 1404: 1403: 1400: 1397: 1394: 1391: 1388: 1384: 1383: 1380: 1378: 1375: 1373: 1371: 1367: 1366: 1363: 1361: 1358: 1356: 1353: 1349: 1348: 1345: 1343: 1340: 1338: 1335: 1331: 1330: 1327: 1325: 1322: 1320: 1318: 1314: 1313: 1310: 1308: 1305: 1303: 1300: 1296: 1295: 1292: 1289: 1286: 1283: 1280: 1276: 1275: 1272: 1269: 1266: 1263: 1260: 1256: 1255: 1252: 1249: 1248:34.8% (40/122) 1246: 1245:39.3% (48/122) 1243: 1240: 1236: 1235: 1232: 1229: 1226: 1223: 1220: 1219:Czech Republic 1216: 1215: 1212: 1209: 1206: 1203: 1200: 1199:Czech Republic 1196: 1195: 1192: 1189: 1186: 1183: 1180: 1176: 1175: 1172: 1169: 1166: 1163: 1160: 1156: 1155: 1152: 1149: 1146: 1143: 1140: 1139:Belarus: Brest 1136: 1135: 1132: 1129: 1126: 1123: 1120: 1116: 1115: 1112: 1109: 1106: 1103: 1100: 1096: 1095: 1090: 1087: 1085:4.72%=(11/233) 1082: 1077: 1072: 1041: 1040: 1037: 1034: 1031: 1028: 1025: 1014: 1013: 1010: 1007: 1002: 997: 992: 970: 969: 966: 963: 960: 957: 954: 943: 942: 939: 936: 933: 932:21.82%=(12/55) 930: 927: 916: 915: 912: 909: 906: 903: 900: 863: 860: 812:Roman Iron Age 774:proto-Germanic 757: 754: 753: 752: 739: 738: 737: 715: 714: 713: 712: 711: 710: 709: 706: 705: 704: 703: 702: 701: 700: 697: 696: 695: 689: 688: 687: 672: 671: 670: 669: 668: 665: 664: 663: 652: 635: 634: 633: 632: 631: 625: 624: 623: 622:I-Z382; I1a2a2 620: 619: 618: 615: 612: 611: 610: 604: 603: 602: 599: 578: 577: 576: 575: 574: 571: 568: 565: 564: 563: 562: 561: 560: 559: 558: 557: 556: 555: 554: 553: 552: 551: 539: 538: 537: 536: 535: 529: 528: 527: 521: 520: 519: 501: 500: 499: 498: 497: 496: 495: 492: 489: 488: 487: 486: 485: 470: 467: 464: 463: 462: 461: 460: 459: 458: 457: 456: 432: 431: 430: 429:A5338; I1a1a4~ 427: 424: 421: 420: 419: 418: 417: 416: 415: 364: 361: 295: 294: 282: 263: 260:Central Europe 248: 233: 197: 194: 146:males, 37% of 134:) and western 120:founder effect 81: 80: 77: 73: 72: 65: 61: 60: 54: 50: 49: 44: 40: 39: 28: 24: 23: 15: 9: 6: 4: 3: 2: 7034: 7023: 7020: 7018: 7015: 7013: 7010: 7009: 7007: 6985: 6976: 6969: 6967: 6962: 6960: 6955: 6948: 6939: 6930: 6921: 6914: 6910: 6904: 6895: 6886: 6877: 6868: 6861: 6860: 6853: 6845: 6841: 6837: 6833: 6829: 6825: 6822:(2): 187–91. 6821: 6817: 6810: 6806: 6802: 6794: 6791: 6789: 6786: 6785: 6781: 6773: 6771: 6766: 6760: 6757: 6750: 6743: 6738: 6733: 6727: 6721: 6715: 6713: 6711: 6700: 6691: 6684: 6679: 6669: 6660: 6653: 6649: 6643: 6641: 6634: 6627: 6620: 6611: 6605: 6604: 6596: 6591: 6590: 6582: 6577: 6576: 6570: 6565: 6557: 6548: 6543: 6542: 6536: 6533: 6528: 6522: 6519: 6514: 6508: 6505: 6500: 6494: 6491: 6484: 6475: 6467: 6460: 6457: 6452: 6445: 6440: 6434: 6431: 6426: 6420: 6417: 6412: 6406: 6403: 6397: 6390: 6387: 6381: 6374: 6370: 6364: 6357: 6353: 6347: 6340: 6336: 6329: 6324: 6314: 6311:February 2021 6302: 6297: 6288: 6287: 6282: 6278: 6270: 6265: 6263: 6258: 6256: 6251: 6250: 6247: 6241: 6238: 6236: 6233: 6231: 6227: 6224: 6222: 6221: 6220: 6214: 6213: 6210: 6207: 6205: 6202: 6200: 6197: 6195: 6192: 6191: 6187: 6186: 6175: 6171: 6167: 6163: 6158: 6153: 6148: 6143: 6139: 6135: 6131: 6127: 6122: 6118: 6114: 6109: 6104: 6100: 6096: 6092: 6088: 6084: 6079: 6075: 6071: 6067: 6063: 6058: 6053: 6049: 6045: 6041: 6036: 6032: 6028: 6023: 6018: 6013: 6008: 6004: 6000: 5996: 5992: 5988: 5983: 5979: 5975: 5971: 5967: 5963: 5959: 5955: 5951: 5947: 5943: 5939: 5934: 5933: 5921: 5916: 5910: 5905: 5897: 5893: 5886: 5878: 5874: 5867: 5853: 5849: 5842: 5835:(in Swedish). 5834: 5833: 5828: 5821: 5807: 5803: 5797: 5783: 5779: 5773: 5759: 5755: 5749: 5735: 5731: 5725: 5710: 5706: 5700: 5686: 5685:slaktingar.se 5682: 5676: 5661: 5657: 5650: 5636: 5632: 5626: 5618: 5614: 5609: 5605: 5599: 5585: 5581: 5575: 5561: 5557: 5551: 5536: 5532: 5526: 5512: 5508: 5502: 5488: 5484: 5478: 5464: 5460: 5454: 5440: 5436: 5430: 5416: 5412: 5406: 5392: 5388: 5381: 5367: 5363: 5357: 5343: 5339: 5333: 5319: 5315: 5309: 5295:on 2020-10-26 5294: 5290: 5286: 5280: 5266: 5262: 5256: 5242: 5241: 5234: 5220: 5216: 5209: 5207: 5205: 5196: 5192: 5188: 5181: 5173: 5172:FamilyTreeDNA 5169: 5163: 5149: 5145: 5139: 5125: 5121: 5115: 5101: 5097: 5091: 5089: 5082: 5079: 5074: 5066: 5062: 5058: 5054: 5051:(1): 138–45. 5050: 5046: 5038: 5030: 5024: 5020: 5019: 5011: 5003: 4999: 4995: 4991: 4986: 4981: 4977: 4973: 4969: 4965: 4961: 4957: 4953: 4946: 4932: 4928: 4922: 4908: 4904: 4898: 4884: 4880: 4874: 4860: 4856: 4850: 4836: 4832: 4826: 4818: 4814: 4808: 4800: 4796: 4792: 4788: 4783: 4778: 4774: 4770: 4766: 4762: 4758: 4751: 4743: 4739: 4734: 4729: 4725: 4721: 4717: 4710: 4702: 4698: 4694: 4690: 4685: 4680: 4676: 4672: 4667: 4662: 4658: 4654: 4650: 4646: 4639: 4631: 4627: 4622: 4617: 4613: 4609: 4605: 4601: 4597: 4593: 4589: 4582: 4574: 4570: 4565: 4560: 4556: 4552: 4548: 4544: 4540: 4536: 4532: 4525: 4517: 4513: 4508: 4503: 4499: 4495: 4491: 4487: 4483: 4479: 4475: 4468: 4460: 4456: 4452: 4445: 4431: 4427: 4420: 4412: 4408: 4403: 4398: 4394: 4390: 4386: 4382: 4378: 4374: 4370: 4363: 4355: 4354: 4346: 4338: 4334: 4329: 4324: 4320: 4316: 4312: 4305: 4297: 4293: 4286: 4279: 4271: 4267: 4263: 4259: 4256:(1): 129–52. 4255: 4251: 4247: 4240: 4225: 4221: 4216: 4211: 4207: 4200: 4193: 4185: 4181: 4176: 4171: 4166: 4161: 4157: 4153: 4150:(6): 593–99. 4149: 4145: 4141: 4134: 4126: 4122: 4117: 4112: 4108: 4104: 4100: 4096: 4092: 4085: 4077: 4073: 4069: 4065: 4060: 4055: 4052:(8): 963–70. 4051: 4047: 4043: 4036: 4028: 4024: 4019: 4014: 4010: 4006: 4002: 3998: 3994: 3987: 3979: 3975: 3970: 3965: 3960: 3955: 3951: 3947: 3943: 3939: 3935: 3928: 3920: 3914: 3906: 3902: 3895: 3888: 3874: 3870: 3864: 3856: 3852: 3848: 3844: 3840: 3836: 3832: 3828: 3824: 3820: 3816: 3809: 3807: 3805: 3796: 3792: 3786: 3778: 3774: 3769: 3764: 3760: 3756: 3752: 3748: 3744: 3737: 3730:. April 2021. 3729: 3728:familytreedna 3725: 3719: 3711: 3707: 3703: 3699: 3694: 3689: 3685: 3681: 3677: 3673: 3669: 3662: 3660: 3651: 3645: 3637: 3633: 3626: 3618: 3614: 3607: 3600: 3592: 3586: 3572: 3568: 3562: 3554: 3550: 3545: 3540: 3536: 3532: 3528: 3524: 3520: 3513: 3499: 3495: 3489: 3475: 3471: 3465: 3463: 3454: 3450: 3445: 3440: 3436: 3432: 3428: 3424: 3420: 3416: 3412: 3405: 3397: 3393: 3388: 3383: 3379: 3375: 3372:(5): 830–38. 3371: 3367: 3363: 3356: 3341: 3337: 3331: 3323: 3319: 3315: 3311: 3308:(2): 207–15. 3307: 3303: 3296: 3288: 3284: 3279: 3274: 3269: 3264: 3260: 3256: 3252: 3248: 3244: 3237: 3230:. April 2021. 3229: 3228:familytreedna 3225: 3219: 3211: 3207: 3202: 3197: 3193: 3189: 3185: 3181: 3177: 3170: 3156: 3152: 3146: 3138: 3134: 3130: 3126: 3119: 3112: 3105: 3099: 3097: 3082: 3078: 3072: 3058: 3054: 3048: 3040: 3036: 3032: 3028: 3024: 3020: 3013: 3005: 2999: 2991: 2987: 2983: 2979: 2975: 2971: 2967: 2963: 2956: 2948: 2944: 2940: 2936: 2931: 2926: 2922: 2918: 2914: 2907: 2905: 2897: 2896: 2889: 2887: 2878: 2874: 2870: 2866: 2861: 2856: 2852: 2848: 2844: 2837: 2829: 2823: 2819: 2811: 2797:on 2009-06-24 2793: 2789: 2785: 2780: 2775: 2771: 2767: 2764:(1): 128–37. 2763: 2759: 2752: 2745: 2737: 2733: 2728: 2723: 2719: 2715: 2711: 2707: 2703: 2699: 2695: 2688: 2686: 2684: 2676: 2672: 2666: 2664: 2648: 2642: 2640: 2638: 2633: 2622: 2619: 2617: 2614: 2612: 2609: 2607: 2604: 2602: 2599: 2597: 2594: 2592: 2589: 2587: 2584: 2582: 2579: 2578: 2569:Region: ARSDP 2568: 2565: 2562: 2559: 2556: 2553: 2550: 2548: 2544: 2541: 2538: 2537: 2536: 2530: 2527: 2524: 2521: 2518: 2515: 2512: 2510: 2506: 2503: 2499: 2495: 2491: 2488: 2487: 2486: 2481: 2477: 2473: 2470: 2467: 2464: 2461: 2458: 2456: 2452: 2449: 2446: 2445: 2444: 2439: 2435: 2431: 2428: 2425: 2422: 2419: 2416: 2413: 2410: 2408: 2404: 2401: 2397: 2394: 2393: 2392: 2389: 2383: 2379: 2367: 2363: 2360: 2356: 2353: 2352:Börje Salming 2349: 2345: 2342: 2338: 2335: 2331: 2328: 2324: 2321: 2317: 2313: 2310: 2306: 2303: 2299: 2296: 2292: 2289: 2286: 2282: 2279: 2277: 2273: 2271: 2267: 2266: 2262: 2258: 2255: 2251: 2248: 2244: 2241: 2237: 2236:Richard Lee I 2233: 2232:Robert E. Lee 2229: 2227: 2223: 2220: 2218: 2214: 2211: 2209: 2205: 2202: 2198: 2194: 2191:, founder of 2190: 2186: 2183: 2180: 2176: 2172: 2168: 2165: 2161: 2157: 2153: 2150: 2146: 2143: 2142:United States 2139: 2136: 2135: 2134: 2130: 2120: 2113: 2109: 2104: 2099: 2094: 2092: 2089: 2085: 2081: 2077: 2073: 2064: 2059: 2050: 2047: 2044: 2041: 2038: 2035: 2034: 2030: 2027: 2024: 2021: 2018: 2016: 2012: 2011: 2007: 2004: 2001: 1998: 1995: 1992: 1991: 1987: 1984: 1981: 1978: 1975: 1972: 1971: 1967: 1964: 1961: 1958: 1955: 1953:Ukraine: Lviv 1952: 1951: 1947: 1944: 1941: 1938: 1935: 1932: 1931: 1927: 1924: 1921: 1918: 1915: 1912: 1911: 1907: 1905: 1902: 1900: 1898: 1895: 1894: 1890: 1888: 1885: 1883: 1881: 1878: 1877: 1873: 1871: 1868: 1866: 1863: 1860: 1859: 1855: 1852: 1849: 1846: 1843: 1840: 1839: 1835: 1832: 1829: 1826: 1823: 1820: 1819: 1815: 1812: 1809: 1806: 1803: 1801:Russia: Vepsa 1800: 1799: 1795: 1793: 1790: 1788: 1785: 1782: 1781: 1777: 1774: 1771: 1768: 1765: 1762: 1761: 1757: 1754: 1751: 1748: 1745: 1742: 1741: 1737: 1734: 1731: 1728: 1725: 1722: 1721: 1717: 1714: 1711: 1708: 1705: 1702: 1701: 1697: 1694: 1691: 1688: 1685: 1682: 1681: 1677: 1674: 1671: 1668: 1665: 1662: 1661: 1657: 1654: 1651: 1648: 1645: 1643:Russia: Pskov 1642: 1641: 1637: 1634: 1631: 1628: 1625: 1622: 1621: 1617: 1615: 1612: 1610: 1607: 1604: 1603: 1599: 1596: 1593: 1590: 1587: 1584: 1583: 1579: 1577: 1574: 1572: 1569: 1566: 1565: 1561: 1559: 1556: 1554: 1551: 1548: 1547: 1543: 1540: 1537: 1534: 1531: 1529: 1526: 1525: 1521: 1518: 1515: 1512: 1509: 1506: 1505: 1501: 1498: 1495: 1492: 1489: 1486: 1485: 1481: 1478: 1475: 1472: 1469: 1466: 1465: 1461: 1458: 1455: 1452: 1449: 1446: 1445: 1441: 1438: 1435: 1432: 1429: 1426: 1425: 1421: 1418: 1415: 1412: 1409: 1406: 1405: 1401: 1398: 1395: 1392: 1389: 1386: 1385: 1381: 1379: 1376: 1374: 1372: 1369: 1368: 1364: 1362: 1359: 1357: 1354: 1352:Finland: East 1351: 1350: 1346: 1344: 1341: 1339: 1336: 1334:Finland: West 1333: 1332: 1328: 1326: 1323: 1321: 1319: 1316: 1315: 1311: 1309: 1306: 1304: 1301: 1298: 1297: 1293: 1290: 1287: 1284: 1281: 1278: 1277: 1273: 1270: 1267: 1264: 1261: 1258: 1257: 1253: 1250: 1247: 1244: 1241: 1238: 1237: 1233: 1230: 1227: 1224: 1221: 1218: 1217: 1213: 1210: 1207: 1204: 1201: 1198: 1197: 1193: 1190: 1187: 1184: 1181: 1178: 1177: 1173: 1170: 1167: 1164: 1161: 1158: 1157: 1153: 1150: 1147: 1144: 1141: 1138: 1137: 1133: 1130: 1127: 1124: 1121: 1118: 1117: 1113: 1110: 1107: 1104: 1101: 1098: 1097: 1091: 1088: 1086: 1083: 1081: 1078: 1076: 1075:55+64+114=233 1073: 1071: 1069: 1065: 1060: 1056: 1051: 1047: 1043: 1042: 1038: 1035: 1033:5.31%=(6/114) 1032: 1030:7.96%=(9/114) 1029: 1026: 1023: 1019: 1016: 1015: 1011: 1008: 1006: 1003: 1001: 998: 996: 993: 991: 989: 985: 980: 976: 972: 971: 967: 964: 961: 959:17.2%=(11/64) 958: 955: 952: 948: 945: 944: 940: 937: 934: 931: 928: 925: 921: 918: 917: 913: 910: 907: 904: 901: 898: 897: 894: 892: 888: 884: 880: 879:United States 875: 873: 869: 859: 857: 852: 850: 845: 843: 839: 835: 830: 826: 824: 823:Saxony-Anhalt 819: 817: 813: 809: 805: 803: 799: 795: 791: 787: 783: 779: 775: 771: 762: 751: 750: 745: 744: 740: 736: 732: 729: 728: 727: 726: 722:(Z131/S249); 721: 720: 716: 707: 698: 693: 692: 690: 685: 684: 682: 681: 679: 678: 676: 675: 673: 666: 661: 660: 658: 657: 656: 655: 653: 650: 649: 647: 646: 645: 644: 640: 636: 629: 628: 626: 621: 616: 613: 608: 607: 605: 600: 597: 596: 594: 593: 591: 590: 588: 587: 586: 582: 579: 572: 569: 566: 549: 548: 546: 545: 543: 542: 540: 533: 532: 530: 525: 524: 522: 517: 516: 514: 513: 511: 510: 508: 507: 505: 504: 502: 493: 490: 483: 482: 480: 479: 477: 476: 474: 473: 471: 468: 465: 454: 453: 451: 450: 448: 447: 445: 444: 442: 441: 439: 438: 436: 435: 433: 428: 425: 423:A394; I1a1a2~ 422: 413: 412: 411: 410: 409: 408: 406: 405: 403: 402: 401: 397: 394: 393: 392: 391: 387:(DF29/S438); 386: 385: 381: 380: 379: 377: 369: 360: 358: 354: 349: 347: 343: 339: 335: 330: 328: 323: 319: 317: 313: 309: 303: 301: 292: 288: 283: 280: 276: 272: 268: 264: 261: 257: 253: 249: 246: 242: 238: 234: 231: 227: 226: 225: 223: 219: 215: 207: 202: 193: 191: 185: 183: 178: 175: 173: 169: 165: 161: 157: 153: 149: 145: 141: 137: 133: 129: 125: 121: 117: 113: 108: 106: 102: 98: 95: 91: 87: 78: 74: 66: 62: 58: 55: 51: 48: 45: 41: 33: 29: 25: 20: 6984: 6975: 6965: 6958: 6953: 6947: 6938: 6929: 6920: 6903: 6894: 6885: 6876: 6867: 6858: 6852: 6819: 6815: 6809: 6800: 6665: 6608: 6308: 6300: 6218: 6157:10261/208851 6133: 6129: 6090: 6086: 6047: 6043: 5994: 5990: 5945: 5941: 5915: 5904: 5895: 5885: 5876: 5866: 5855:. Retrieved 5851: 5841: 5830: 5820: 5809:. Retrieved 5805: 5796: 5785:. Retrieved 5781: 5772: 5761:. Retrieved 5757: 5748: 5737:. Retrieved 5733: 5724: 5713:. Retrieved 5711:(in Swedish) 5708: 5699: 5688:. Retrieved 5684: 5675: 5663:. Retrieved 5659: 5649: 5638:. Retrieved 5634: 5625: 5615:– via 5604:Ghostarchive 5602:Archived at 5598: 5587:. Retrieved 5583: 5574: 5563:. Retrieved 5559: 5550: 5539:. Retrieved 5537:(in Swedish) 5534: 5525: 5514:. Retrieved 5510: 5501: 5490:. Retrieved 5486: 5477: 5466:. Retrieved 5462: 5453: 5442:. Retrieved 5438: 5429: 5418:. Retrieved 5414: 5405: 5394:. Retrieved 5390: 5380: 5369:. Retrieved 5365: 5356: 5345:. Retrieved 5341: 5332: 5321:. Retrieved 5317: 5308: 5297:. Retrieved 5293:the original 5288: 5285:"Swedenborg" 5279: 5268:. Retrieved 5264: 5255: 5245:, retrieved 5243:(in Russian) 5239: 5233: 5222:. Retrieved 5218: 5194: 5191:ResearchGate 5190: 5180: 5171: 5162: 5151:. Retrieved 5147: 5138: 5127:. Retrieved 5123: 5114: 5103:. Retrieved 5099: 5080: 5073: 5048: 5044: 5037: 5017: 5010: 4959: 4955: 4945: 4934:. Retrieved 4930: 4921: 4910:. Retrieved 4906: 4897: 4886:. Retrieved 4882: 4873: 4862:. Retrieved 4858: 4849: 4838:. Retrieved 4834: 4825: 4816: 4807: 4764: 4760: 4750: 4723: 4719: 4709: 4648: 4644: 4638: 4598:(1): 10326. 4595: 4591: 4581: 4538: 4534: 4524: 4481: 4477: 4467: 4458: 4455:ResearchGate 4454: 4444: 4433:. Retrieved 4429: 4419: 4376: 4372: 4362: 4352: 4345: 4318: 4314: 4304: 4295: 4291: 4278: 4253: 4249: 4239: 4227:. Retrieved 4206:biorxiv.org/ 4205: 4192: 4147: 4143: 4133: 4098: 4094: 4084: 4049: 4045: 4035: 4000: 3996: 3986: 3941: 3937: 3927: 3913: 3904: 3900: 3887: 3876:. Retrieved 3872: 3863: 3822: 3818: 3794: 3785: 3750: 3746: 3736: 3727: 3718: 3675: 3671: 3635: 3625: 3616: 3612: 3599: 3585: 3574:. Retrieved 3570: 3561: 3526: 3522: 3512: 3501:. Retrieved 3497: 3488: 3477:. Retrieved 3473: 3418: 3414: 3404: 3369: 3365: 3355: 3344:. Retrieved 3342:. 2013-02-22 3339: 3330: 3305: 3301: 3295: 3250: 3246: 3236: 3227: 3218: 3183: 3179: 3169: 3158:. Retrieved 3154: 3145: 3128: 3124: 3111: 3103: 3084:. Retrieved 3080: 3071: 3060:. Retrieved 3056: 3047: 3025:(1): 10–19. 3022: 3018: 3012: 2998: 2968:(1): 61–73. 2965: 2961: 2955: 2920: 2916: 2894: 2850: 2846: 2836: 2817: 2810: 2799:. Retrieved 2792:the original 2761: 2757: 2744: 2701: 2697: 2670: 2651:. Retrieved 2554:ISOGG HG: I1 2534: 2516:ISOGG HG: I1 2492:Source: PS ( 2484: 2462:ISOGG HG: I1 2442: 2420:ISOGG HG: I1 2390: 2387: 2309:Samuel Morse 2132: 2117: 2111: 2107: 2096: 2068: 1528:Volga Tatars 1360:19% (58/306) 1342:40% (92/230) 1084: 1079: 1074: 1044: 1005:4.2%=(5/119) 1004: 999: 994: 973: 908:I1 (I-M253) 902:Sample size 876: 865: 853: 846: 831: 827: 820: 806: 767: 748: 747: 742: 741: 734: 730: 724: 723: 718: 717: 642: 641:(S243/Z63); 638: 584: 583:(S244/Z58); 580: 399: 395: 389: 388: 383: 382: 375: 367: 366: 350: 331: 324: 320: 304: 296: 241:Stora Karlsö 211: 186: 181: 179: 176: 167: 109: 94:Y chromosome 89: 85: 84: 5734:ancestry.se 5213:Maciamo E. 4985:10852/83989 4684:10852/83989 4379:(1): 3547. 3421:(1): 7152. 3278:10852/71890 2621:Norse Sagas 2443:Name: M307 2391:Name: M253 2359:Edmund Rice 2261:Leo Tolstoy 2185:Birger Jarl 2078:during the 1913:Switzerland 1585:Netherlands 962:4.7%=(3/64) 935:3.6%=(2/55) 899:Population 887:New Zealand 854:During the 849:Anglo-Saxon 788:before the 782:Scandinavia 659:I-CTS10345 336:. However, 308:Pitted Ware 271:Scandinavia 218:Paleolithic 164:Bryan Sykes 64:Descendants 7006:Categories 6138:Cell Press 5857:2023-10-07 5811:2020-12-10 5787:2020-12-10 5763:2021-02-02 5739:2021-02-02 5715:2021-02-02 5690:2021-02-02 5665:2 February 5640:2021-02-02 5589:2021-02-14 5565:2021-02-14 5541:2021-02-14 5516:2021-02-14 5492:2020-12-10 5468:2020-12-10 5444:2020-12-10 5420:2020-12-26 5396:2020-12-26 5371:2020-12-26 5347:2021-01-03 5323:2021-01-03 5299:2020-12-10 5270:2020-12-10 5247:2020-12-15 5224:2020-12-11 5153:2020-12-11 5129:2020-12-10 5105:2020-11-23 4936:2020-12-10 4912:2020-12-10 4888:2020-12-10 4864:2020-12-10 4840:2020-12-10 4435:2020-12-11 4229:27 January 3878:2021-01-24 3576:2022-12-25 3503:2022-12-25 3479:2022-12-25 3346:2020-12-10 3160:2020-12-10 3131:: 347–49. 3086:2020-12-27 3062:2020-11-26 2801:2008-03-20 2653:2022-04-19 2647:"I1 YTree" 2628:References 2563:YCC HG: I1 2545:Position: 2535:Name: P40 2525:YCC HG: I1 2507:Position: 2485:Name: P30 2471:YCC HG: I1 2453:Position: 2429:YCC HG: I1 2405:Position: 2341:Chris Pine 905:I (total) 872:Viking Age 856:Viking Age 842:Ostrogoths 506:I-FT40464 222:Mesolithic 214:Gravettian 97:haplogroup 6966:PhyloTree 6801:Footnotes 5560:yfull.com 5265:yfull.com 5021:. Brill. 5002:221769227 4907:sikaby.se 4859:sikaby.se 4817:isogg.org 4701:201195157 4321:: 63–77. 4262:0935-3518 4224:196631764 3873:yfull.com 3710:206556994 3571:yfull.com 3498:yfull.com 2990:205598345 2551:Length: 1 2539:Type: SNP 2513:Length: 1 2489:Type: SNP 2459:Length: 1 2447:Type: SNP 2417:Length: 1 2395:Type: SNP 2226:Mayflower 2193:Stockholm 2156:Vorontsov 2149:Varangian 2084:North Sea 2013:Ukraine: 1567:Lithuania 1055:Albanians 1046:Albanians 995:55+64=119 984:Albanians 975:Albanians 947:Albanians 920:Albanians 883:Australia 838:Visigoths 731:I-CTS6397 691:I-S10360 686:I-FGC9550 550:I-FT57000 547:I-Y22015 544:I-Y19932 541:I-Y19933 531:I-Y24013 523:I-Y22918 515:I-Y31032 509:I-Y19934 396:I-CTS6364 363:Structure 208:peoples. 156:Icelandic 148:Norwegian 140:Satakunta 116:Neolithic 6963:, and; 6954:op. cit. 6844:23291764 6836:24166809 6474:F-Y27277 6240:I1 YTree 6226:Archived 6174:76663708 6166:30880015 6117:31594508 6066:19781941 6031:32457149 5970:26062507 5890:snpdev. 5871:snpdev. 5758:Geneanet 5606:and the 5487:geni.com 5065:21596538 4994:32939067 4791:12781138 4742:12082121 4693:32939067 4630:26783717 4573:30872528 4516:31699931 4411:30206220 4337:56295624 4270:40849016 4184:27111036 4125:31594508 4076:23227271 4068:16724001 4027:25487325 3978:30988179 3847:26062507 3777:25808890 3753:(1805). 3702:24762536 3644:cite web 3553:31594508 3453:25988751 3396:18385274 3322:16644145 3287:29853688 3210:10931763 3039:16337760 2982:19040656 2947:32079904 2939:18294359 2877:32079904 2869:18294359 2788:15162323 2736:25988751 2704:: 7152. 2574:See also 2346:Swedish 2177:(son of 2015:Cherkasy 1841:Slovenia 1821:Slovakia 1179:Bulgaria 1068:Pristina 1022:Pristina 743:I-Z17943 694:I-S15301 683:I-L1237 677:I-S2077 674:I-S2078 662:I-Y10994 534:I-Y24015 526:I-Y21972 518:I-Y32014 277:and the 206:Germanic 53:Ancestor 6678:K-M2313 6671: 6612: 6597: 6583: 6567: 6558: 6549: 6371: 6354: 6301:updated 6108:6790770 6074:9487217 6022:7293694 5999:Bibcode 5978:4399103 5950:Bibcode 5896:nih.gov 5877:nih.gov 5617:YouTube 5219:Eupedia 4964:Bibcode 4661:bioRxiv 4653:Bibcode 4621:4735653 4600:Bibcode 4564:6436108 4543:Bibcode 4535:Science 4507:7093155 4486:Bibcode 4478:Science 4402:6134036 4381:Bibcode 4175:4884158 4116:6790770 4018:4275881 3969:6511028 3946:Bibcode 3855:4399103 3827:Bibcode 3768:4389623 3680:Bibcode 3672:Science 3544:6790770 3444:4441248 3423:Bibcode 3387:2336805 3255:Bibcode 3247:Science 3201:1287529 2893:ISOGG, 2779:1181996 2727:4441248 2706:Bibcode 2496:of the 2373:Markers 2295:Finnish 2201:Denmark 2173:Prince 2171:Rurikid 2091:Vikings 2076:Denmark 1507:Ireland 1487:Hungary 1447:Germany 1299:Estonia 1279:Estonia 1259:England 1239:Denmark 1099:Austria 914:Source 816:Lombard 794:Vistula 699:I-Y7234 667:I-Y7075 630:I-Z2541 609:I-L1302 378: 334:Denmark 252:Hungary 245:Gotland 230:Azilian 196:Origins 162:males. 160:Finnish 144:Swedish 136:Finland 122:in the 92:, is a 6913:K-M526 6842: 6834: 6701: 6697: 6692: 6680: 6661: 6488: 6480: 6476: 6471: 6172: 6164: 6115: 6105: 6072: 6064: 6029: 6019: 5976: 5968: 5942:Nature 5289:Höijen 5063: 5025: 5000: 4992: 4956:Nature 4799:526263 4797: 4789: 4740: 4699: 4691: 4663: 4645:Nature 4628: 4618: 4571: 4561: 4514: 4504: 4409: 4399: 4335: 4268: 4260: 4222: 4182: 4172: 4123: 4113: 4074: 4066: 4025: 4015: 3976: 3966: 3853: 3845: 3819:Nature 3775: 3765: 3708: 3700: 3613:Nature 3551: 3541: 3451: 3441: 3394: 3384: 3320: 3285: 3208: 3198: 3037: 2988: 2980: 2945: 2937: 2875: 2867: 2824: 2786: 2776: 2734: 2724: 2320:Svante 2197:Norway 2114:(2002) 2112:et al. 2108:et al. 2088:Danish 1933:Turkey 1605:Norway 1549:Latvia 1467:Greece 1407:France 1387:France 1159:Bosnia 1050:Tirana 979:Tirana 924:Tirana 891:Canada 870:, the 834:Girona 808:I1-Z63 719:I-Z131 617:I-L803 614:I-L573 606:I-Z73 598:I-L338 384:I-DF29 368:I-M253 353:Y-Full 267:kurgan 152:Danish 128:Sweden 107:(I*). 59:(M170) 6840:S2CID 6490:GHIJK 6170:S2CID 6136:(7). 6070:S2CID 5974:S2CID 4998:S2CID 4795:S2CID 4697:S2CID 4333:S2CID 4288:(PDF) 4266:JSTOR 4220:S2CID 4202:(PDF) 4072:S2CID 3897:(PDF) 3851:S2CID 3706:S2CID 3609:(PDF) 3121:(PDF) 2986:S2CID 2943:S2CID 2873:S2CID 2795:(PDF) 2754:(PDF) 2208:Sting 2152:Šimon 802:Goths 639:I-Z63 581:I-Z58 374:) or 357:95 CI 172:Wodan 6832:PMID 6659:K2b1 6504:HIJK 6396:A1b1 6352:A0-T 6162:PMID 6113:PMID 6062:PMID 6027:PMID 5966:PMID 5667:2021 5197:: 9. 5061:PMID 5023:ISBN 4990:PMID 4787:PMID 4738:PMID 4689:PMID 4626:PMID 4569:PMID 4512:PMID 4407:PMID 4258:ISSN 4231:2021 4180:PMID 4121:PMID 4064:PMID 4023:PMID 3974:PMID 3843:PMID 3773:PMID 3698:PMID 3650:link 3549:PMID 3449:PMID 3392:PMID 3318:PMID 3302:Gene 3283:PMID 3206:PMID 3129:1261 3035:PMID 2978:PMID 2935:PMID 2865:PMID 2822:ISBN 2784:PMID 2732:PMID 2500:and 2348:Sámi 2285:Boer 2245:The 2238:and 2169:The 2162:and 2147:The 2074:and 2042:26.8 2022:28.1 1999:26.2 1979:21.4 1959:23.8 1886:38.0 1847:26.3 1827:14.3 1791:15.2 1749:24.7 1729:15.8 1709:19.8 1689:12.6 1672:11.3 1669:26.4 1649:16.9 1632:12.5 1608:1766 1591:20.4 1538:11.3 1535:13.2 1496:13.3 1493:25.7 1473:15.8 1456:15.2 1436:11.9 1433:21.4 1416:16.7 1413:16.7 1393:17.2 1324:28.0 1307:11.9 1288:14.8 1285:18.6 1268:15.4 1265:19.2 1225:17.0 1205:31.9 1185:26.6 1145:20.6 889:and 847:The 784:and 735:I1b1 643:I1a3 585:I1a2 400:I1a1 346:Elbe 220:and 101:SNPs 6824:doi 6742:P1a 6737:P1b 6732:P1c 6720:NO1 6648:K2a 6640:K2b 6633:K2c 6626:K2d 6619:K2e 6513:IJK 6386:A1b 6380:A1a 6346:A00 6152:hdl 6142:doi 6103:PMC 6095:doi 6091:286 6052:doi 6017:PMC 6007:doi 5995:117 5958:doi 5946:522 5920:P40 5909:P30 5053:doi 5049:194 4980:hdl 4972:doi 4960:585 4777:hdl 4769:doi 4728:doi 4679:hdl 4671:doi 4649:585 4616:PMC 4608:doi 4559:PMC 4551:doi 4539:363 4502:PMC 4494:doi 4482:366 4397:PMC 4389:doi 4323:doi 4254:104 4210:doi 4170:PMC 4160:hdl 4152:doi 4111:PMC 4103:doi 4099:286 4054:doi 4013:PMC 4005:doi 4001:370 3964:PMC 3954:doi 3942:116 3835:doi 3823:522 3763:PMC 3755:doi 3751:282 3688:doi 3676:344 3539:PMC 3531:doi 3527:286 3439:PMC 3431:doi 3382:PMC 3374:doi 3310:doi 3306:376 3273:hdl 3263:doi 3251:360 3196:PMC 3188:doi 3133:doi 3027:doi 3023:164 2970:doi 2925:doi 2855:doi 2774:PMC 2766:doi 2722:PMC 2714:doi 2478:to 2436:to 2382:DNA 2048:0.0 2045:5.3 2028:0.0 2025:4.3 2019:114 2005:0.0 2002:6.1 1996:176 1985:0.0 1982:1.8 1965:0.0 1962:4.9 1956:101 1945:0.0 1942:1.1 1939:5.4 1936:523 1925:0.0 1922:5.6 1919:7.6 1916:144 1864:160 1853:0.0 1850:7.4 1833:0.0 1830:4.3 1813:0.0 1810:2.6 1807:5.1 1786:132 1775:0.0 1772:8.6 1766:140 1755:0.0 1752:4.5 1735:0.0 1732:7.6 1726:145 1715:0.0 1712:3.1 1695:0.0 1692:1.9 1686:103 1675:0.0 1655:0.0 1652:5.4 1646:130 1635:0.0 1597:0.0 1575:4.9 1570:164 1557:3.5 1552:113 1541:0.0 1519:0.0 1516:6.0 1510:100 1499:0.0 1490:113 1479:0.0 1476:2.3 1470:171 1459:0.0 1450:125 1439:0.0 1419:0.0 1399:1.7 1396:8.6 1377:50+ 1355:306 1337:230 1302:118 1291:0.5 1282:210 1271:0.0 1262:104 1251:0.0 1242:122 1231:0.0 1228:1.9 1211:0.0 1208:8.5 1191:0.0 1188:4.3 1182:808 1171:0.0 1168:2.0 1162:100 1151:0.0 1148:1.0 1131:0.0 1128:1.0 1122:100 1111:0.0 1108:2.3 1105:9.3 1089:0.0 1036:0.0 1027:114 1009:0.0 965:0.0 938:0.0 749:I1c 725:I1b 390:I1a 258:of 243:on 182:I1a 174:". 7008:: 6956:; 6838:. 6830:. 6820:35 6818:. 6710:P1 6595:J2 6589:J1 6581:I2 6575:I1 6564:K2 6556:LT 6527:IJ 6483:F3 6466:F1 6430:CF 6425:DE 6416:CT 6402:BT 6369:A1 6363:A0 6337:" 6168:. 6160:. 6150:. 6134:29 6132:. 6128:. 6111:. 6101:. 6089:. 6085:. 6068:. 6060:. 6048:19 6046:. 6042:. 6025:. 6015:. 6005:. 5993:. 5989:. 5972:. 5964:. 5956:. 5944:. 5940:. 5894:. 5875:. 5850:. 5804:. 5780:. 5756:. 5732:. 5707:. 5683:. 5658:. 5633:. 5610:: 5582:. 5558:. 5533:. 5509:. 5485:. 5461:. 5437:. 5413:. 5389:. 5364:. 5340:. 5316:. 5287:. 5263:. 5217:. 5203:^ 5193:. 5189:. 5170:. 5146:. 5122:. 5098:. 5087:^ 5059:. 4996:. 4988:. 4978:. 4970:. 4958:. 4954:. 4929:. 4905:. 4881:. 4857:. 4833:. 4815:. 4793:. 4785:. 4775:. 4765:13 4763:. 4759:. 4736:. 4724:19 4722:. 4718:. 4695:. 4687:. 4677:. 4669:. 4659:. 4647:. 4624:. 4614:. 4606:. 4594:. 4590:. 4567:. 4557:. 4549:. 4537:. 4533:. 4510:. 4500:. 4492:. 4480:. 4476:. 4457:. 4453:. 4428:. 4405:. 4395:. 4387:. 4375:. 4371:. 4331:. 4319:14 4317:. 4313:. 4296:43 4294:. 4290:. 4264:. 4252:. 4248:. 4218:. 4208:. 4204:. 4178:. 4168:. 4158:. 4148:48 4146:. 4142:. 4119:. 4109:. 4097:. 4093:. 4070:. 4062:. 4050:14 4048:. 4044:. 4021:. 4011:. 3999:. 3995:. 3972:. 3962:. 3952:. 3940:. 3936:. 3903:. 3899:. 3871:. 3849:. 3841:. 3833:. 3821:. 3817:. 3803:^ 3793:. 3771:. 3761:. 3749:. 3745:. 3726:. 3704:. 3696:. 3686:. 3674:. 3670:. 3658:^ 3646:}} 3642:{{ 3634:. 3617:23 3615:. 3611:. 3569:. 3547:. 3537:. 3525:. 3521:. 3496:. 3472:. 3461:^ 3447:. 3437:. 3429:. 3417:. 3413:. 3390:. 3380:. 3370:18 3368:. 3364:. 3338:. 3316:. 3304:. 3281:. 3271:. 3261:. 3249:. 3245:. 3226:. 3204:. 3194:. 3184:67 3182:. 3178:. 3153:. 3127:. 3123:. 3095:^ 3079:. 3055:. 3033:. 3021:. 2984:. 2976:. 2966:73 2964:. 2941:. 2933:. 2921:72 2919:. 2915:. 2903:^ 2885:^ 2871:. 2863:. 2851:72 2849:. 2845:. 2782:. 2772:. 2762:75 2760:. 2756:. 2730:. 2720:. 2712:. 2700:. 2696:. 2682:^ 2662:^ 2636:^ 2293:, 2283:, 2039:56 1976:56 1903:52 1844:95 1824:70 1804:39 1769:10 1746:89 1706:96 1666:53 1629:25 1626:16 1594:14 1588:93 1532:53 1513:11 1453:24 1430:42 1410:12 1390:58 1222:53 1202:47 1165:42 1142:97 1125:15 1102:43 956:64 929:55 893:. 885:, 881:, 844:. 804:. 733:; 376:I1 340:, 192:. 90:I1 57:I* 32:BP 6846:. 6826:: 6770:Q 6765:R 6756:O 6749:N 6699:M 6690:S 6668:P 6610:T 6603:L 6547:J 6541:I 6532:K 6518:H 6499:G 6456:F 6451:C 6444:E 6439:D 6411:B 6333:" 6313:) 6309:( 6303:. 6268:e 6261:t 6254:v 6176:. 6154:: 6144:: 6119:. 6097:: 6076:. 6054:: 6033:. 6009:: 6001:: 5980:. 5960:: 5952:: 5898:. 5879:. 5860:. 5814:. 5790:. 5766:. 5742:. 5718:. 5693:. 5669:. 5643:. 5619:. 5592:. 5568:. 5544:. 5519:. 5495:. 5471:. 5447:. 5423:. 5399:. 5374:. 5350:. 5326:. 5302:. 5273:. 5227:. 5195:1 5156:. 5132:. 5108:. 5067:. 5055:: 5031:. 5004:. 4982:: 4974:: 4966:: 4939:. 4915:. 4891:. 4867:. 4843:. 4819:. 4801:. 4779:: 4771:: 4744:. 4730:: 4703:. 4681:: 4673:: 4655:: 4632:. 4610:: 4602:: 4596:7 4575:. 4553:: 4545:: 4518:. 4496:: 4488:: 4459:1 4438:. 4413:. 4391:: 4383:: 4377:9 4339:. 4325:: 4272:. 4233:. 4212:: 4186:. 4162:: 4154:: 4127:. 4105:: 4078:. 4056:: 4029:. 4007:: 3980:. 3956:: 3948:: 3921:. 3905:1 3881:. 3857:. 3837:: 3829:: 3797:. 3779:. 3757:: 3712:. 3690:: 3682:: 3652:) 3638:. 3593:. 3579:. 3555:. 3533:: 3506:. 3482:. 3455:. 3433:: 3425:: 3419:6 3398:. 3376:: 3349:. 3324:. 3312:: 3289:. 3275:: 3265:: 3257:: 3212:. 3190:: 3163:. 3135:: 3089:. 3065:. 3041:. 3029:: 3006:. 2992:. 2972:: 2949:. 2927:: 2879:. 2857:: 2830:. 2804:. 2768:: 2738:. 2716:: 2708:: 2702:6 2656:. 2480:A 2476:G 2438:T 2434:C 2402:) 2368:. 2361:. 2354:. 2311:. 2304:. 2263:. 2256:. 2242:. 2144:. 1070:) 1066:( 1061:) 1057:( 1052:) 1048:( 1024:) 1020:( 990:) 986:( 981:) 977:( 953:) 949:( 926:) 922:( 370:( 281:. 262:.

Text is available under the Creative Commons Attribution-ShareAlike License. Additional terms may apply.

Index